Crudia zeylanica — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Crudia

At a glance

Occurrence records14

Data sources6

Biological traits6

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Crudia zeylanica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

NCBIUS National Library of Medicinesequences↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF14 records

DNA & barcodingNCBIsequences

01Narrative

Crudia zeylanica (), sometimes known as Sri Lanka legume, is a species of plant in the family Fabaceae endemic to Sri Lanka. Once thought to be extinct, the plant was rediscovered in 2019.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climatewet tropical

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crudia zeylanica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOK139134.1 ↗529 bp

ACGT

ATTATACTCCTGACTATGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTCCCGCCCGAAGAAGCAG …

Crudia zeylanica voucher MGC_06 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL10

plant barcode

08Occurrence & distribution

Record type14 records

Museum / vouchered14

Range

Area of Occupancy AOO36 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	1

1 institutions · 1 of 14 vouchered records shown · 13 without an institution code