Cruciata glabra

(L.) Opiz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Cruciata

At a glance

Occurrence records3 605

Data sources12

Biological traits41

DNA specimens3

eDNA detections2

Sources12 archives

Databases and archives Cruciata glabra's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 605 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF3 605 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT704 Mbp

01Narrative

Cruciata glabra, smooth crosswort, is a species of flowering plant in the genus Cruciata, native to Morocco, Algeria, southern, central and eastern Europe, the Caucasus, Kazakhstan, the Altai, and western Siberia. It is often found in beech (Fagus sylvatica) forests.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology11

Plant height0.2 m

⚠ sources differ — GIFT: 0.2 m · LEDA: 0.2 m · TRY: 0.144 m

Plant height generative0.2 m

Plant height max0.5 m

Plant height min0.08 m

Seed length2 mm

Seed mass1.43 mg

Seed mass max1.43 mg

Seed mass min1.43 mg

Seed volume1.3 mm³

Seed volume max1.3 mm³

Seed volume min1.3 mm³

Life cycle & reproduction12

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typehuman

Flowering endAug

Flowering startApr

Life formperennial

Life spanperennial

Lifespan years1 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Seed number243 185

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formherb

Habitat GIFTforest, meadows, mountains

Mycorrhiza typenon-mycorrhizal

Woodinessnon-woody

Physiology & chemistry6

Leaf C:N ratio25.09 g/g

Leaf c445 mg/g

Leaf dry-matter content (LDMC)303 mg/g

Leaf n17.37 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)11.83 mm²/mg

Other traits2

Diaspore typegenerative dispersule

Shoot orientationprostrate

03Chemical composition5 compounds

Compounds documented for Cruciata glabra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Simple coumarins3

Iridoids monoterpenoids2

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
Daphnetin	present	LOTUS
Daphnetin-8-glucoside	present	LOTUS
Daphnin	present	LOTUS
Desacetylasperulosidic acid	present	LOTUS
Scandoside	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cruciata glabra has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU974044.1 ↗271 bp

ACGT

TTGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCCTCGAACGACCGCGAACAAGTTT …

Cruciata glabra 18S ribosomal RNA gene, and internal transcribed spacer 1, region

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Cruciata glabra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size704 160 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cruciata glabra0.70 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidy2× diploid · measured

Chromosome records22–442n range44median44mode21records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4411×CCDB · slov-fl · CCDB · fl-europaea · CCDB · poland +5

CCDB · slov-fl — Feráková V. & Murín A., 1976: [Report], pp. 490-491. - In: Löve Á. (ed.), IOPB Chromosome Number Reports LIII, Taxon 25 /4.

CCDB · fl-europaea — Ancev, 1976

CCDB · poland — Piotrowicz M. 1958. Karyological studies in some species of the genus Galium L. Acta Biol. Cracov. Ser. Bot. 1, 159-169.

CCDB · book-ipcn75-78 — Ferakova & Murin 1976

CCDB · book-ipcn75-78 — Ancev 1976a

CCDB · book-ipcn73-74 — SUROVA, T.D. 1973. Chromosome numbers of some species of genera Galium L. and Cruciata Mill. of the North-West European part of the u.s.s-.-R-.---- (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1819-1824.

CCDB · book-ipcn73-74 — ANCEV, M.E. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.

CCDB · Cave1959 — Piotrowicz 1958

CCDB · Cave1963 — Ehrendorfer 1962

CCDB · CromoCat 2015 — Ancev, M. E. (1974b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 806.

CCDB · CromoCat 2015 — Feráková, V. & Murín, A. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIII]. Taxon 25(4): 490-491.

2n 229×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · ipcn-api-dl +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · fl-europaea — Ehrendorfer, ined

CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.

CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers in some nemoral species of the West Sayan (Krasnoyarsk region). Bot. Žhurn. (Moscow & Leningrad) 79(3): 125–128.

CCDB · kew — Temsch EM, Temsch W, Ehrendorfer-Schratt L, Greilhuber J. 2010. Heavy metal pollution, selection, and genome size: The species of the Žerjav study revisited with flow cytometry. Journal of Botany 2010: Article ID 596542, 11 pages.

CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha

CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.

2n 401×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 605 records

Wild obs. + sensor2 959

Museum / vouchered632

Other14

Range

Area of Occupancy AOO10 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 462≤1 km 229≤10 km 88>10 km 27

1 806 georeferenced · 1 153 without coordinates

Open the mapobservation + sensor2 959

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 28≤1 km 5≤10 km 7>10 km 3

43 georeferenced · 589 without coordinates

Open the institutions mapphysical evidence632

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	531
LDlocation not on record	27
Oskarshamn, SE	12
Provincia di Livornolocation not on record	12
Bergen, NO	3
Uppsala, SE	3
SLU Artdatabankenlocation not on record	3
Saint Louis, US	2
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	1
Beijing, CN	1
Ivano-Frankove, UA	1
Natural History Museum Rotterdamlocation not on record	1
Karlsruhe, DE	1
Trondheim, NO	1
KMNlocation not on record	1
Yugra State University Biological Collectionlocation not on record	1

16 institutions · 601 of 632 vouchered records shown · 22 without an institution code

09Environmental DNA2 detections

Where the DNA of Cruciata glabra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cruciata glabra

At a glance

Sources12 archives

Size & morphology11

Life cycle & reproduction12

Diet & foraging1

Habitat & environment9

Physiology & chemistry6

Other traits2

Compound class profile2 classes

Documented compounds5 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 605 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 605 records