Crowea saligna

Andrews · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Crowea

At a glance

Occurrence records1 482

Data sources6

Biological traits36

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Crowea saligna's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 482 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF1 482 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 38

01Narrative

Crowea saligna est une espèce de plantes à fleurs de la famille des Rutaceae. Il s'agit d'un petit buisson de 1 à 1,5 m de haut, endémique de l'est de la Nouvelle-Galles du Sud en Australie. Le terme Crowea est un hommage à James Crowe, chirurgien et botaniste anglais (1750/1751-1807). Le terme saligna vient du latin et signifie du saule ; cela fait référence à une vague ressemblance des feuilles de cet arbuste avec celles des saules.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length7 mm

Leaf length45 mm

Leaf length max60 mm

Leaf length min30 mm

Leaf mass per area155 g/m2

Leaf size109 mm²

Leaf width8.5 mm

Leaf width max13 mm

Leaf width min4 mm

Plant height1.25 m

⚠ sources differ — AusTraits: 1.25 m · TRY: 1 m

Plant height max1.5 m

Seed length3.8 mm

Seed mass10.6 mg

⚠ sources differ — TRY: 10.6 mg · AusTraits: 11.07 mg · GIFT: 10.32 mg

Seed mass max12.01 mg

Seed mass min8.63 mg

Seed width2.18 mm

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal+self

Flowering timenyyyyynnnnnn

Life spanperennial

Lifespan years10 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical widely_elliptical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crowea saligna has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP524224.1 ↗699 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAATGACCCGCGAACTCGTGAACACACCGGAG …

Crowea saligna isolate R60 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crowea saligna carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 482 records

Wild obs. + sensor1 297

Museum / vouchered182

Cultivated / captive3

Origin

Native68

Introduced1

Range

Area of Occupancy AOO1 128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 793≤1 km 201≤10 km 53>10 km 19

1 066 georeferenced · 231 without coordinates

Open the mapobservation + sensor1 297

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 15≤1 km 10≤10 km 102>10 km 25

152 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence182

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	69
Museo Entomologico de Leonlocation not on record	23
Canberra, AU	22
Armidale, AU	17
Adelaide, AU	15
Brisbane, AU	10
Kew, GB	3
Hobart, AU	3
John T. Waterhouse Herbariumlocation not on record	3
Auckland, NZ	3
Parkville, AU	2
Kensington, AU	2
Flagstaff, US	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Wollongong, AU	1
Christchurch, NZ	1
La Trobe Universitylocation not on record	1
Cambridge University Herbariumlocation not on record	1

18 institutions · 178 of 182 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crowea saligna

At a glance

Sources6 archives

Size & morphology16

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 482 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Cultivated / Captivenot free-living

Record type1 482 records