Crowea angustifolia

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Crowea

At a glance

Occurrence records225

Data sources8

Biological traits23

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Crowea angustifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility225 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF225 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 38

01Narrative

Crowea angustifolia is a flowering plant in the family Rutaceae, and is endemic to the south-west of Western Australia. It is an erect shrub growing to 3 m high by 1.0 m in diameter with white or pink flowers in spring.C. angustifolia var. platyphylla

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length3.5 mm

Leaf length35 mm

Leaf width10.5 mm

Plant height3 m

Plant height max3.5 m

Plant height min0.3 m

Seed length2.25 mm

Life cycle & reproduction4

Flowering timennnnnnnnyyyy

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typemericarp

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear obovate widely_elliptical

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crowea angustifolia has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN082857.1 ↗686 bpAustralia

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCGAAGCAGAATGACCCGTGAACTTGTGAAAACACCGGAG …

Crowea angustifolia var. platyphylla voucher NSW 1003687 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crowea angustifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · book-fedorov

CCDB · book-fedorov — Smith-White 1954b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type225 records

Wild obs. + sensor158

Museum / vouchered67

Origin

Native3

Range

Area of Occupancy AOO448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 100≤1 km 20≤10 km 7>10 km 7

134 georeferenced · 24 without coordinates

Open the mapobservation + sensor158

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 12≤1 km 1≤10 km 36

49 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	55
Mount Annan, AU	3
BGPAlocation not on record	3
Kew, GB	2
Boise, US	1
Wellington, NZ	1
Brisbane, AU	1
Adelaide, AU	1

8 institutions · 67 of 67 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)