Croton verreauxii

Baill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records1 956

Data sources10

Biological traits38

DNA specimens5

eDNA detections3

Sources10 archives

Databases and archives Croton verreauxii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 956 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Chemical compositionLOTUS · NPASS12 compounds

Occurrence & distributionGBIF1 956 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Croton verreauxii known as the green native cascarilla is a small tree or shrub growing in dry rainforest and rainforest margins in eastern Australia. The range of natural distribution is from Kiama (34° S) in the Illawarra district of eastern New South Wales to Gympie (27° S) in south eastern Queensland. Alexander Floyd mentions a recording of this species at Darwin, Northern Territory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology16

Fruit length6 mm

Fruit width6 mm

Leaf length85 mm

Leaf length max120 mm

Leaf length min50 mm

Leaf mass1 109 mg

Leaf mass per area87.72 g/m2

Leaf size12 631 mm²

Leaf width30 mm

Leaf width max30 mm

Leaf width min15 mm

Petiole length1.5 cm

Plant height17.5 m

⚠ sources differ — AusTraits: 17.5 m · TRY: 1.3 m

Seed length2 mm

Seed mass15.13 mg

Seed width2 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal+self

Flowering timeynnnnnnnnnyy

Life formshrub or tree

Life span>30

⚠ sources differ — TRY: >30 · AusTraits: perennial · GIFT: perennial

Lifespan years30 years

Raunkiær life formphanerophyte

Resprouting capacityfire_killed

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: shrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)11.39 mm²/mg

03Chemical composition12 compounds

Compounds documented for Croton verreauxii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Spongiane diterpenoids4

Secoabietane diterpenoids1

Colensane and Clerodane diterpenoids1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(3aR,3bR,4R,5aS,9aS,9bR,11aR)-4-hydroxy-3b,6,6,9a-tetramethyl-3,3a,4,5,5a,7,8,9,9b,10,11,11a-dodecahydronaphtho[2,1-e][2]benzofuran-1-one	present	NPASS
[(3aR,3bR,5aS,9aS,9bR,10S)-3a-hydroxy-3b,6,6,9a-tetramethyl-1-oxo-4,5,5a,7,8,9,9b,10-octahydro-3H-naphtho[2,1-e][2]benzofuran-10-yl] acetate	present	NPASS
[(3aS,3bS,4S,5aS,9aS,9bR,10S)-10-acetyloxy-3b,6,6,9a-tetramethyl-1-oxo-3,3a,4,5,5a,7,8,9,9b,10-decahydronaphtho[2,1-e][2]benzofuran-4-yl] acetate	present	NPASS
[(3bR,4S,5aS,9aS,9bR,10S)-10-acetyloxy-3b,6,6,9a-tetramethyl-1-oxo-3,4,5,5a,7,8,9,9b,10,11-decahydronaphtho[2,1-e][2]benzofuran-4-yl] acetate	present	NPASS
Croverin	present	LOTUS
Dorisenone A	present	NPASS
methyl (1R,2R,4S,9S,10R,13R,14R)-2-acetyloxy-5,5,9-trimethyl-15-oxo-16-oxatetracyclo[8.7.0.01,14.04,9]heptadecane-13-carboxylate	present	NPASS
SJUIUZNWNSLYJG-QVFLUTGASA-N	present	NPASS
Spongian-16-one	present	NPASS
SPWYWLLHMLQUGG-RMGCFARWSA-N	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton verreauxii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes6

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY971257.1 ↗667 bpAustralia

ACGT

TTGCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACTCGTGAACAAGTAAGACAACACTCGGGTGACCAA …

Croton verreauxii voucher Berry 7683 (WIS), cultivated at Sydney Botanical Garden internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 956 records

Wild obs. + sensor1 629

Museum / vouchered308

Cultivated / captive1

Other18

Origin

Native90

Introduced1

Range

Area of Occupancy AOO4 264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 466≤1 km 85≤10 km 40>10 km 3

1 594 georeferenced · 35 without coordinates

Open the mapobservation + sensor1 629

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 45≤1 km 18≤10 km 116>10 km 80

259 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence308

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	91
Museo Entomologico de Leonlocation not on record	72
Brisbane, AU	70
Canberra, AU	23
Armidale, AU	16
Adelaide, AU	4
Wollongong, AU	4
Kew, GB	4
Smithfield, AU	3
Cambridge University Herbariumlocation not on record	2
Batemans Bay, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Museo Nacional de Costa Rica (MNCR)location not on record	1

14 institutions · 296 of 308 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Croton verreauxii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 18.6–21.5

Seasonal swing summer↔winter10.6 °C

Max temp (day)24.4 °C 23.2–27.7

Min temp (night)15.0 °C 14.5–15.5

Precipitation89.6 mm/mo 30.4–124

Air humidity58.8 % 46.5–60.5

Moisture balance-29.8 mm/mo -120–4.90

Vapour deficit958 Pa 850–1,491

Wind speed3.10 m/s 2.70–3.80

Cloud cover24.6 % 19.4–25.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Croton verreauxii

At a glance

Sources10 archives

Size & morphology16

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Compound class profile3 classes

Documented compounds12 total

At a glance

Record type1 956 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 14 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 956 records