Croton socotranus

Balf.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records81

Data sources7

Biological traits10

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Croton socotranus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF81 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Croton socotranus est une espèce de plantes à fleurs du genre Croton et de la famille des Euphorbiaceae, présente à Socotra. Il a deux sous-espèces : - Croton socotranus var. pachyclados (Radcl.-Sm.) Radcl.-Sm., 1989 présent à Socotra et ayant pour synonyme : - - Croton pachyclados, Radcl.-Sm., 1971 - (en) UICN : espèce Croton socotranus Balf.f., 1884 - (en) Catalogue of Life : Croton socotranus pachyclados (Radcl.-Sm.) Radcl.-Sm. et - Croton socotranus var. socotranus - (en) Catalogue of Life : Croton socotranus socrotanus

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton socotranus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY971250.1 ↗663 bpYemen

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACTCGTGAACAAGTAATACAACACTCGGGTGACCTC …

Croton socotranus voucher Lavranos & James 31042 (RSA), cultivated in California internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

08Occurrence & distribution

Record type81 records

Wild obs. + sensor50

Museum / vouchered31

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 28≤1 km 4≤10 km 1>10 km 2

35 georeferenced · 15 without coordinates

Open the mapobservation + sensor50

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 31 records without

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	8
Stockholm, SE	4
Kew, GB	4
Wlocation not on record	3
MAlocation not on record	1
Moscow State Universitylocation not on record	1
MeiseBGlocation not on record	1
Frankfurt am Main	1
Edinburgh, GB	1
BClocation not on record	1

10 institutions · 25 of 31 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Croton socotranus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.9 °C 27.9–27.9

Seasonal swing summer↔winter13.2 °C

Max temp (day)33.3 °C

Min temp (night)19.6 °C

Precipitation4.50 mm/mo

Air humidity40.4 %

Moisture balance-167 mm/mo

Vapour deficit2,322 Pa

Wind speed2.80 m/s

Cloud cover9.40 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)