Croton setigerus

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records296

Data sources11

Biological traits9

DNA specimens0

eDNA detections0

Sources11 archives

Databases and archives Croton setigerus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility296 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources9 traits

Chemical compositionLOTUS · NPASS5 compounds

Occurrence & distributionGBIF296 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT · NCBI≈474 Mbp

01Narrative

Croton setigerus est une espèce de plantes à fleurs du genre Croton et de la famille des Euphorbiaceae, présente de l'ouest des États-Unis jusqu'au Mexique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Size & morphology1

Seed mass5.65 mg

Life cycle & reproduction1

Life spanannual

Habitat & environment2

Growth formherb

Woodinessnon-woody

Physiology & chemistry5

Leaf C:N ratio19.47 g/g

Leaf c393 mg/g

Leaf dry-matter content (LDMC)339 mg/g

Leaf n20.2 mg/g

Specific leaf area (SLA)17.96 mm²/mg

03Chemical composition5 compounds

Compounds documented for Croton setigerus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclophytane diterpenoids1

Hydrocarbons1

Flavonols1

Monosaccharides1

Colensane and Clerodane diterpenoids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,4R,4aR,8aR)-4-[2-(furan-3-yl)ethyl]-3,4,8,8a-tetramethyl-1,3,4a,5-tetrahydronaphthalene-2,6-dione	present	LOTUS
Hautriwaic Acid	present	LOTUS
Mannitol	present	NPASS
N-Triacontane	present	NPASS
Tiliroside	present	LOTUS

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton setigerus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences9

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP878372.1 ↗649 bpUSA

ACGT

CCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACTCGCGAACAAGTAAGACAACCCCCGGGTGACCTTTGGAGCCTTCGGGT …

Croton setiger voucher Van Ee 1842 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Croton setigerus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈473 660 150 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Croton setigerus0.47 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×GoaT · Tree of Sex Database · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

GoaT · Tree of Sex Database — ↗

CCDB · book-fedorov — Heiser, Whitaker 1948

CCDB · book-atlas-flowering-plants — Heiser & W. 1948

n 101×CCDB · book-ipcn66

CCDB · book-ipcn66 — Miller & Webster 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type296 records

Wild obs. + sensor6

Museum / vouchered290

Origin

Native10

Range

Area of Occupancy AOO1 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 9≤1 km 84≤10 km 73>10 km 8

174 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence290

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	42
Arcata, US	36
Corvallis, US	30
CASlocation not on record	26
US	23
St. Paul, US	14
Philadelphia, US	12
Davis, US	9
EL PASO, US	9
San Diego, US	8
Claremont, US	8
Boise, US	7
Bloomington, US	6
IDElocation not on record	5
Henderson, US	5
Northridge, US	5
Tacoma, US	5
WTUlocation not on record	5
University of Stellenboschlocation not on record	4
Madison, US	3
Flagstaff, US	2
Pocatello, US	2
Phoenix, US	2
Bureau of Land Management, Medford District Officelocation not on record	2
UC Berkeley, Blue Oak Ranch Reservelocation not on record	2
Fort Worth, US	2
Denver, US	1
Moscow, US	1
Chicago, US	1
Provo, US	1
Oskarshamn, SE	1
San Luis Obispo, US	1
ASUlocation not on record	1
Caldwell, US	1
Austin, US	1
Santa Barbara, US	1
VALElocation not on record	1
Chadron, US	1
Pullman, US	1
IPA/SPlocation not on record	1

40 institutions · 288 of 290 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)