Croton pottsii

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records1 198

Data sources12

Biological traits13

DNA specimens5

eDNA detections20

Sources12 archives

Databases and archives Croton pottsii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 198 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 198 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · TreeOfSex2n = 40

01Narrative

Croton pottsii is a species of plant known by the common name leatherweed. It is native to the southwestern United States and northern Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass6.6 mg

Seed mass max6.6 mg

Seed mass min6.6 mg

Life cycle & reproduction3

Life formperennial or subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton pottsii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections20

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFJ614746.1 ↗729 bpUSA

ACGT

TTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGAC …

Croton pottsii var. thermophilus voucher MICH:Webster 4439 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10ITS2

fungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Croton pottsii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 203×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.

TreeOfSex · plant — Goldblatt1979 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 198 records

Wild obs. + sensor523

Museum / vouchered675

Range

Area of Occupancy AOO3 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 304≤1 km 50≤10 km 25>10 km 42

421 georeferenced · 102 without coordinates

Open the mapobservation + sensor523

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 113≤1 km 50≤10 km 99>10 km 24

286 georeferenced · 389 without coordinates

Open the institutions mapphysical evidence675

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions35 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	132
Bronx, US	75
ASUlocation not on record	59
EL PASO, US	46
Austin, US	43
Durango, MX	43
Fort Worth, US	35
Albuquerque, US	28
Lubbock, US	26
Mexico City, MX	19
San Angelo, US	18
Saint Louis, US	14
Ann Arbor, US	13
Chicago, US	13
Phoenix, US	12
Riverside, US	12
Hermosillo, MX	9
Flagstaff, US	7
Tampa, US	6
Davis, US	5
BAYLUlocation not on record	5
San Diego, US	5
Guasave, MX	4
Madison, US	4
Bloomington, US	4
Claremont, US	4
Juriquilla, MX	3
Chapingo, MX	3
University of Stellenboschlocation not on record	3
USFSlocation not on record	2
The University of Arizonalocation not on record	2
Zacatecas, MX	2
Kew, GB	1
Jena Microbial Resource Collectionlocation not on record	1
South Kensington, GB	1
Provo, US	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
Wuzhou, CN	1
Henderson, US	1
Emporia, US	1
Giardini Botanici Hanburylocation not on record	1
MEXUlocation not on record	1
AUAlocation not on record	1
Pullman, US	1
Durango, US	1
New Mexico Museum of Natural History and Sciencelocation not on record	1

46 institutions · 670 of 675 vouchered records shown · 2 without an institution code

09Environmental DNA20 detections

Where the DNA of Croton pottsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 198 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions35 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 198 records