Croton persimilis

Müll.Arg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records74

Data sources8

Biological traits13

DNA specimens0

eDNA detections2

Sources8 archives

Databases and archives Croton persimilis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Croton persimilis fruit at Peravoor, Kerala, India Croton persimilis is a species of tree in the Euphorbiaceae family. It is native to an area from Thailand in mainland Southeast Asia to southern Yunnan, China and to the Indian subcontinent. It is a pioneer species with a short life span. The plant is used in the traditional medicines of various peoples.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height8 m

Life cycle & reproduction4

Deciduousnessdeciduous

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton persimilis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF523366.1 ↗687 bpIndia · 2013

ACGT

ATGTCACCCCAAACAGAAACTAAAGCAAGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGAGTATCAA …

Croton persimilis voucher 17706 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Croton persimilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Soontornchainaksaeng, P., P. Chantaranothai & C. Senakun. 2003. Genetic diversity of Croton L. (Euphorbiaceae) in Thailand. Cytologia 68: 379–382.

CCDB · book-indian_vol1 — Bedi, Y.S. et al. 1980

n 104×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & V. K. Singhal. 1981. Cytomorphological studies in north Indian pomegranate (Punica granatum Linn.). J. Cytol. Genet. 16: 35–45.

CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.

CCDB · book-ipcn67-71 — MEHRA, P.N., & A.S. HANS. 1969. In IOPB chromosome number reports XXI. Taxon 18: 310-315.

CCDB · book-ipcn75-78 — Mehra 1976

n 114×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1972. Chromosome survey of certain angiosperms. I. Bull. Bot. Surv. India 14: 170.

CCDB · ipcn-api-dl — Bedi, Y. S., S. S. Bir & B. S. Gill. 1980. In Chromosome number reports LXVII. Taxon 29: 353–355.

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1972. Chromosome survey of certain angiosperms---I. Bull. Bot. Surv. India 14: 170.

CCDB · book-ipcn75-78 — Sarkar et al. 197 2

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type74 records

Wild obs. + sensor65

Museum / vouchered9

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 4≤10 km 1

5 georeferenced · 60 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 3>10 km 1

4 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Baroda, IN	3
Saint Louis, US	3
Cincinnati, US	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1

4 institutions · 8 of 9 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Croton persimilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)