Croton michauxii

G.L.Webster · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records1 042

Data sources9

Biological traits10

DNA specimens2

eDNA detections4

Sources9 archives

Databases and archives Croton michauxii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 042 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF1 042 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Croton michauxii, commonly known as elliptical rushfoil, and Michaux's croton, is a plant species in the family Euphorbiaceae that is native to the United States. It is an annual plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton michauxii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences8

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHM564089.1 ↗644 bpUSA

ACGT

CCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACTCGTGAACAAGTAAGACAACACCTGGGTGACCAATGGGGCCTGCGGTG …

Croton michauxii var. elliptica voucher Cusick 33275 (MICH) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 042 records

Wild obs. + sensor611

Museum / vouchered431

Range

Area of Occupancy AOO2 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 332≤1 km 43≤10 km 15>10 km 76

466 georeferenced · 145 without coordinates

Open the mapobservation + sensor611

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 12≤1 km 27≤10 km 66>10 km 10

115 georeferenced · 316 without coordinates

Open the institutions mapphysical evidence431

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	126
Tampa, US	85
Jena Microbial Resource Collectionlocation not on record	48
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	27
Saint Louis, US	23
Valdosta State Universitylocation not on record	16
Austin, US	12
Tuscaloosa, US	11
Fort Worth, US	10
Jackson, US	7
Columbia, US	6
Tall Timbers Research Stationlocation not on record	6
BAYLUlocation not on record	6
University of Stellenboschlocation not on record	4
Bronx, US	3
Little Rock, US	3
Dekalb, US	3
Riverside, US	3
US	3
Chapel Hill, US	3
EL PASO, US	2
Logan, US	2
Mississippi State, US	2
Northridge, US	1
Emporia, US	1
LINUlocation not on record	1
San Angelo, US	1
Clemson, US	1
GAlocation not on record	1
Phoenix, US	1
AUAlocation not on record	1
Tempe, US	1
Burlington, US	1
University of Tennessee at Chattanoogalocation not on record	1
Claremont, US	1
McWane Science Centerlocation not on record	1
DOI/NPS, Selma to Montgomery National Historic Traillocation not on record	1
Florida Museum of Natural Historylocation not on record	1

38 institutions · 426 of 431 vouchered records shown · 5 without an institution code

09Environmental DNA4 detections

Where the DNA of Croton michauxii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Croton michauxii

At a glance

Sources9 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Record type1 042 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 042 records