Croton megalocarpus

Hutch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records153

Data sources11

Biological traits24

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Croton megalocarpus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionDukesPhytochem · LOTUS21 compounds

Occurrence & distributionGBIF153 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Croton megalocarpus is a tree species in the family Euphorbiaceae. It is indigenous to ten countries in Sub-Saharan Africa, including Somalia, Kenya, Uganda, Democratic Republic of the Congo, Rwanda, Burundi, Tanzania, Malawi, Zambia, and Mozambique.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Plant height30.5 m

⚠ sources differ — GIFT: 30.5 m · TRY: 0.95 m

Plant height min6 m

Seed mass1 000 mg

Seed mass max1 000 mg

Seed mass min1 000 mg

Seed volume1 200 mm³

Seed volume max1 200 mm³

Seed volume min1 200 mm³

Life cycle & reproduction4

Deciduousnessevergreen

⚠ sources differ — TRY: E · GIFT: deciduous

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Growth formtree

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)333 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density565 mg/cm³

03Chemical composition21 compounds

Compounds documented for Croton megalocarpus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Taraxerane triterpenoids3

Lupane triterpenoids3

Labdane diterpenoids2

Norlabdane diterpenoids1

Cinnamic acids and derivatives1

Documented compounds21 total

Tissue Source Quantified only

Compound	Class	Amount	Source
BETULIN		25 ppm	DukesPhytochem

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton megalocarpus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMZ489777.1 ↗445 bpTanzania

ACGT

TATGCGATAGCCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTCGGCCGAGGGCAC …

Croton megalocarpus voucher MIB:SASS 0425 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS9

plant barcodefungal barcode

08Occurrence & distribution

Record type153 records

Wild obs. + sensor70

Museum / vouchered83

Range

Area of Occupancy AOO416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 13≤1 km 2

15 georeferenced · 55 without coordinates

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1>10 km 2

3 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	17
TAFORI-LSRClocation not on record	13
Kew, GB	9
MeiseBGlocation not on record	6
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	5
Ann Arbor, US	3
Fort Worth, US	3
WAGlocation not on record	2
Stockholm, SE	1
Bronx, US	1
Kunming, CN	1
MAlocation not on record	1
National Range Agencylocation not on record	1
North Carolina Zoological Parklocation not on record	1
University of Stellenboschlocation not on record	1
BISHlocation not on record	1
Eduardo Mondlane Universitylocation not on record	1
Arusha, TZ	1
Honolulu, US	1

19 institutions · 69 of 83 vouchered records shown · 14 without an institution code

09Environmental DNA2 detections

Where the DNA of Croton megalocarpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)