Croton mamillatus

P.I.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records32

Data sources6

Biological traits10

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Croton mamillatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility32 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF32 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Croton mamillatus est une espèce de plantes à fleurs du genre Croton et de la famille Euphorbiaceae présente au Queensland en Australie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraits

Size & morphology5

Leaf length55 mm

Leaf width24 mm

Plant height4 m

Seed length4.5 mm

Seed width3.5 mm

Life cycle & reproduction1

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton mamillatus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP878354.1 ↗363 bpAustralia

ACGT

CCTGCGGAAGGATCATTGTTCGAAACCTGCACAGCAGAACGACTCGTGAACAAGTAATACAACACTCGGGTGACCTCTGGGGCCTTCGGG …

Croton mamillatus voucher BRI Bean 20145 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type32 records

Wild obs. + sensor6

Museum / vouchered25

Other1

Origin

Native2

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2≤10 km 1>10 km 2

5 georeferenced · 1 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 11≤1 km 4≤10 km 1

16 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	10
Museo Entomologico de Leonlocation not on record	4
Mount Annan, AU	2
Cambridge, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Armidale, AU	1
Saint Louis, US	1
Madison, US	1

8 institutions · 21 of 25 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Croton mamillatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 19.9–19.9

Seasonal swing summer↔winter10.4 °C

Max temp (day)24.2 °C

Min temp (night)15.9 °C

Precipitation83.7 mm/mo

Air humidity58.3 %

Moisture balance-36.8 mm/mo

Vapour deficit978 Pa

Wind speed2.80 m/s

Cloud cover24.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)