Croton macrostachyus

Hochst. ex Delile · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records743

Data sources8

Biological traits28

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Croton macrostachyus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility743 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF743 records

DNA & barcodingNCBIsequences

01Narrative

Croton macrostachyus est une espèce de plantes à fleurs du genre Croton et de la famille Euphorbiaceae présente en Afrique tropicale et sur Madagascar. Il a pour synonymes : - Croton acuminatus, R.Br., 1814 - Croton butaguensis, De Wild, 1921 - Croton guerzesiensis, Beille, 1917 - Croton guerzesiensis, Beille ex A.Chev., 1920 - Croton macrostachyus var. mollissimus, Chiov., 1939 - Oxydectes macrostachya, Kuntze - Rottlera schimperi, Hochst. & Steud.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length10 mm

Fruit width10 mm

Plant height17.5 m

⚠ sources differ — GIFT: 17.5 m · TRY: 30 m

Plant height max15.24 m

Plant height min3 m

Seed mass61 mg

Seed mass max86 mg

Seed mass min40 mg

Life cycle & reproduction8

Deciduousnessdeciduous

Dispersal typeanimal

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeother

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density479 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Croton macrostachyus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
methyl (2S,6aR,10aR,10bS)-2-(furan-3-yl)-5-hydroxy-6a,10b-dimethyl-4-oxo-1,2,6,10a-tetrahydrobenzo[f]isochromene-7-carboxylate		present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton macrostachyus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP878352.1 ↗753 bpUganda

ACGT

TGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGC …

Croton macrostachyus voucher WIS ATBP 709 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type743 records

Wild obs. + sensor333

Museum / vouchered395

Cultivated / captive15

Range

Area of Occupancy AOO1 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 15≤1 km 2

17 georeferenced · 316 without coordinates

Open the mapobservation + sensor333

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤1 km 5≤10 km 1>10 km 5

11 georeferenced · 384 without coordinates

Open the institutions mapphysical evidence395

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 15

15 georeferenced

Open the mapnot free-living15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	71
Kew, GB	50
MeiseBGlocation not on record	22
Yaoundé, CM	21
WAGlocation not on record	20
National Museums of Kenyalocation not on record	15
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	9
Instituto de Investigação Científica Tropicallocation not on record	7
CJBGlocation not on record	5
Uppsala, SE	3
Herbier National du Gabonlocation not on record	3
Paris, FR	3
Fort Worth, US	2
Moscow State Universitylocation not on record	2
MAlocation not on record	2
Arusha, TZ	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	2
Leiden University Medical Centerlocation not on record	2
Plocation not on record	1
Xiamen, CN	1
EFGlocation not on record	1
Davis, US	1
Berlin, DE	1
Southern Highlands Conservation Programmelocation not on record	1
CNF-UFHBlocation not on record	1
University of Stellenboschlocation not on record	1
Chongqing Museumlocation not on record	1
DSMlocation not on record	1
BRLUlocation not on record	1
Glocation not on record	1
EAlocation not on record	1
Addis Ababa, ET	1
TAFORI-LSRClocation not on record	1

33 institutions · 256 of 395 vouchered records shown · 139 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)