Croton laevigatus

Vahl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records143

Data sources9

Biological traits27

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Croton laevigatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Chemical compositionLOTUS · NPASS28 compounds

Occurrence & distributionGBIF143 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈846 Mbp

01Narrative

Croton laevigatus est une espèce de plantes à fleurs du genre Croton et de la famille Euphorbiaceae présente de l'Inde à la Chine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length10 mm

Fruit length max10 mm

Fruit length min10 mm

Fruit width8 mm

Fruit width max8 mm

Fruit width min8 mm

Leaf length125 mm

Leaf length max180 mm

Leaf length min70 mm

Leaf width max55 mm

Leaf width min30 mm

Plant height12.5 m

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max600 m

Elevation mean325 m

Elevation min50 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density530 mg/cm³

03Chemical composition28 compounds

Compounds documented for Croton laevigatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Labdane diterpenoids7

Cembrane diterpenoids6

Stigmastane steroids2

Simple phenolic acids1

Flavones1

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,4aS,8aS)-5,5,8a-trimethyl-1-[(2E)-3-methylpenta-2,4-dienyl]-1,4,4a,6,7,8-hexahydronaphthalene-2-carbaldehyde	present	LOTUS
(1R,4aS,8aS)-5,5,8a-trimethyl-1-[(2E)-3-methylpenta-2,4-dienyl]-1,4,4a,6,7,8-hexahydronaphthalene-2-carboxylic acid	present	LOTUS
(2R,3R,4aS,8S,8aR)-4,4,8a-trimethyl-7-methylidene-8-[(2E)-3-methylpenta-2,4-dienyl]-2,3,4a,5,6,8-hexahydro-1H-naphthalene-2,3-diol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[(1S,4S,5R)-4-[(3R)-3-hydroxybutyl]-3,3,5-trimethylcyclohexyl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(4aS,8S,8aS)-4,4,7,8a-tetramethyl-8-[(2E)-3-methylpenta-2,4-dienyl]-1,2,3,4a,5,8-hexahydronaphthalene	present	LOTUS
11-Hydroxy-5,9-dimethyl-12-propan-2-yl-13-oxabicyclo[10.2.2]hexadeca-1,5,9-trien-14-one	present	LOTUS
3-(4-hydroxy-3,5-dimethoxy-phenyl)propyl Benzoate	present	LOTUS
5,9-Dihydroxy-5,9-dimethyl-12-propan-2-yl-13-oxabicyclo[10.2.2]hexadeca-1,6,10-trien-14-one	present	LOTUS
5,9-Dimethyl-12-propan-2-ylcyclotetradeca-1,5,9,11-tetraene-1-carboxylic acid	present	LOTUS
5-Hydroperoxy-9-hydroxy-5,9-dimethyl-12-propan-2-yl-13-oxabicyclo[10.2.2]hexadeca-1,6,10-trien-14-one	present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton laevigatus has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC758674.1 ↗303 bpChina

ACGT

TTTCGTAGGTGACCTGCGGAGGATCATTGTCGAAACCTGCATAGCAGAACGACTCGTGAACAAGTAAGACAACACTTGGGTGACCTCTGG …

Croton laevigatus voucher npccDNA11 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Croton laevigatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈846 199 020 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Croton laevigatus0.85 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type143 records

Museum / vouchered143

Range

Area of Occupancy AOO124 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence143

10Collections & institutions

Holding institutions15 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	33
Beijing, CN	32
Guilin, CN	17
Bronx, US	16
Kunming, CN	10
Nanjing, CN	7
Chengdu, CN	6
Guangzhou, CN	4
Cincinnati, US	3
Changsha, CN	3
South China Normal Universitylocation not on record	2
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	2
Edinburgh, GB	2
Xiamen, CN	1
Stockholm, SE	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Wuhan, CN	1
Saint Louis, US	1

18 institutions · 142 of 143 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)