Croton alabamensis

E.A.Sm. ex Chapm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Croton

At a glance

Occurrence records237

Data sources9

Biological traits15

DNA specimens1

eDNA detections26

Sources9 archives

Databases and archives Croton alabamensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF237 records

Environmental DNA1 datasets · 1 countries26 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Croton alabamensis var. texensis is a variety of Croton alabamensis that is endemic to the state of Texas in the United States. It is commonly known as the Texabama croton.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max2.44 m

Plant height min1.83 m

Seed mass70.99 mg

Seed mass max70.99 mg

Seed mass min70.99 mg

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Croton alabamensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences10

eDNA detections26

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY971179.1 ↗663 bpUSA

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCATAGCAGAACGACTCGTGAACAAGTAAGAAAACACCAGGGCGAGCTT …

Croton alabamensis var. texensis voucher Nesom 7850 (NY) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL3★ITS6

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type237 records

Wild obs. + sensor165

Museum / vouchered72

Range

Area of Occupancy AOO412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 73≤1 km 10≤10 km 2>10 km 62

147 georeferenced · 18 without coordinates

Open the mapobservation + sensor165

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤1 km 7≤10 km 13>10 km 7

27 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ann Arbor, US	10
Bangkok, TH	7
Chicago, US	6
Philadelphia, US	6
Madison, US	5
Jackson, US	4
Knoxville, US	3
Tuscaloosa, US	3
Bronx, US	3
Lubbock, US	2
University of Stellenboschlocation not on record	2
AUAlocation not on record	2
St. Paul, US	2
University of Southern Mississippilocation not on record	2
Chongqing Museumlocation not on record	2
Fort Worth, US	2
Austin, US	2
Columbia, US	1
Jena Microbial Resource Collectionlocation not on record	1
Mississippi State, US	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
Clemson, US	1
Saint Louis, US	1
US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

26 institutions · 72 of 72 vouchered records shown

09Environmental DNA26 detections

Where the DNA of Croton alabamensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)