Crotalaria sagittalis
speciesAt a glance
Occurrence records3 016
Data sources10
Biological traits20
DNA specimens0
eDNA detections0
Sources10 archives
Databases and archives Crotalaria sagittalis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 016 records↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources20 traits
Chemical compositionLOTUS2 compounds
Occurrence & distributionGBIF3 016 records
DNA & barcodingNCBIsequences
Genome at a glanceCCDB2n = 32
01Narrative
Crotalaria sagittalis, la crotalaire sagittée, est une espèce de plantes à fleurs dicotylédones de la famille des Fabaceae, sous-famille des Faboideae, originaire du continent américain.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYGIFT
Size & morphology4
Plant height0.25 m
Seed mass6.59 mg
Seed mass max8.3 mg
Seed mass min5.4 mg
Life cycle & reproduction3
Life formannual or subshrub
Life spanannual
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTCampo Limpo, Cerrado (lato sensu), Savana Amazônica
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)261 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)13.86 mm²/mg
03Chemical composition2 compounds
Compounds documented for Crotalaria sagittalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile1 class
Pyrrolizidine alkaloids2
Documented compounds2 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 4,5-Dihydroxy-3,4,5-trimethyl-4,5,8,10,12,13,13a,13b-octahydro-2H-[1,6]dioxacycloundecino[2,3,4-gh]pyrrolizine-2,6(3H)-dione | present | LOTUS | |
| Monocrotaline | present | LOTUS |
05DNA & barcoding6 sequences
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crotalaria sagittalis has left across the world's sequence archives.
At a glance
Marker genes3
GenBank sequences6
Countries1
The DNA barcodea real sequence read deposited for this species
TTCGAAGCCTCGCAAGCAGTGCGACCCGTGGATTTGTTTGACATGTGAGGGGATGGCTAGAGGTTTTCTCGTCCTCGGTCCCCCTCGTGT …
Crotalaria sagittalis voucher Beck 21186 (M) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★ITS1
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Crotalaria sagittalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidydiploid inferred
Chromosome records16–322n range32median32mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 324×CCDB · ipcn-api-dl · CCDB · book-fedorov
CCDB · ipcn-api-dl — Verma, R. C., K. Kesavacharyulu & S. N. Raina. 1984. Cytogenetics of Crotalaria IX. Mitotic complements in nineteen species. Cytologia 49: 157–169.
CCDB · ipcn-api-dl — Verma, R. C. & S. N. Raina. 1983. Cytogenetics of Crotalaria VIII. Male meiosis in 26 species. Cytologia 48: 719–733.
CCDB · book-fedorov — Turner, Fearing 1960b
CCDB · book-fedorov — Huynh 1965
2n 161×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.
n 163×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74
CCDB · book-ipcn65 — Huynh 1965
CCDB · ipcn-api-dl — Verma, R. C. & S. N. Raina. 1983. Cytogenetics of Crotalaria VIII. Male meiosis in 26 species. Cytologia 48: 719–733.
CCDB · book-ipcn73-74 — WINDLER, D.R. 1974. Chromosome numbers for native North American unifoliolate species of Crotalaria (Leguminosae). Brittonia 26: 172-176
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 016 records
Wild obs. + sensor788
Museum / vouchered2 222
Cultivated / captive1
Other5
Origin
Native7
Introduced23
Range
Area of Occupancy AOO8 792 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy73% within 1 km
≤100 m 379≤1 km 72≤10 km 14>10 km 153
618 georeferenced · 170 without coordinates
Open the mapobservation + sensor788
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 441≤1 km 201≤10 km 445>10 km 72
1 159 georeferenced · 1 063 without coordinates
Open the institutions mapphysical evidence2 222
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions101 of 164 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 259 |
| Philadelphia, US | 187 |
| Durango, MX | 162 |
| Mexico City, MX | 128 |
| Bronx, US | 91 |
| Wuzhou, CN | 90 |
| Austin, US | 73 |
| National Biodiversity Institute, Costa Ricalocation not on record | 69 |
| Jackson, US | 51 |
| Chongqing Museumlocation not on record | 43 |
| University of Stellenboschlocation not on record | 36 |
| Ann Arbor, US | 34 |
| ASUlocation not on record | 33 |
| Bangkok, TH | 30 |
| Mississippi State, US | 28 |
| Williamsburg, US | 28 |
| Antiguo Cuscatlán, SV | 25 |
| Universidad Nacional de Colombia (UNAL)location not on record | 23 |
| New Haven, US | 22 |
| Burlington, US | 20 |
| Tuscaloosa, US | 20 |
| College Park, US | 19 |
| Kew, GB | 18 |
| Ciudad de México, MX | 18 |
| Fort Worth, US | 18 |
| CASlocation not on record | 17 |
| Jena Microbial Resource Collectionlocation not on record | 17 |
| Bloomington, US | 17 |
| Claremont, US | 17 |
| Mexico City, MX | 15 |
| Culiacán, MX | 14 |
| LDlocation not on record | 14 |
| Riverside, US | 14 |
| Allentown, US | 12 |
| La Paz, MX | 12 |
| Guasave, MX | 12 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 12 |
| San José, CR | 11 |
| US | 11 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 11 |
| San Diego, US | 10 |
| Universidad de Caldas (UCaldas)location not on record | 10 |
| Chicago, US | 9 |
| Pittsburg, US | 9 |
| Little Rock, US | 9 |
| Tuxtla Gutiérrez, MX | 9 |
| Madison, US | 9 |
| Davenport, US | 9 |
| Zacatecas, MX | 8 |
| University of New Hampshirelocation not on record | 8 |
| León, NI | 8 |
| University of Southern Mississippilocation not on record | 8 |
| Universidad de Antioquia (UdeA)location not on record | 8 |
| BAYLUlocation not on record | 8 |
| Tuxtla Gutiérrez, MX | 8 |
| Chadron, US | 8 |
| Puebla, MX | 7 |
| Phoenix, US | 7 |
| Chapel Hill, US | 6 |
| San Isidro, AR | 6 |
| Toluca, MX | 6 |
| Tapachula, MX | 6 |
| Durham, US | 5 |
| UFMSlocation not on record | 5 |
| Flagstaff, US | 5 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 5 |
| Berlin, DE | 5 |
| Columbia, US | 5 |
| GAlocation not on record | 5 |
| Hermosillo, MX | 5 |
| South Kensington, GB | 5 |
| AUAlocation not on record | 5 |
| San Francisco, US | 5 |
| Lincoln, US | 4 |
| Fayetteville, US | 4 |
| Mérida, MX | 4 |
| Washington, US | 4 |
| Paleontological Collectionlocation not on record | 4 |
| MEXUlocation not on record | 4 |
| Knoxville, US | 4 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 4 |
| Xiamen, CN | 4 |
| Aarhus, DK | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 3 |
| Davis, US | 3 |
| Loja, EC | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Tampa, US | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Dover, US | 3 |
| Cambridge, US | 3 |
| Dekalb, US | 3 |
| San Angelo, US | 3 |
| Brookings, US | 3 |
| University of Zhejianglocation not on record | 3 |
| Millersville, US | 3 |
| Chapingo, MX | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| RBGlocation not on record | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| OTSlocation not on record | 2 |
| Austin, US | 2 |
| Keene State Universitylocation not on record | 2 |
| Jefferson City, US | 2 |
| Asheville, US | 2 |
| GB | 2 |
| New Brunswick, US | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| La Paz, BO | 2 |
| Museum of Zoologylocation not on record | 2 |
| Stockholm, SE | 2 |
| Mount Berry, US | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Edmonton, CA | 2 |
| Ciudad de México, MX | 2 |
| Autlán de Navarro, MX | 2 |
| Juriquilla, MX | 2 |
| Mexico City, MX | 1 |
| LINUlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Beijing, CN | 1 |
| Tlalnepantla, MX | 1 |
| UTPLlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Conway, US | 1 |
| Lubbock, US | 1 |
| Staten Island, US | 1 |
| Northridge, US | 1 |
| Waverly, US | 1 |
| Indiana University Southeastlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Wlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Emporia, US | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Longwood Universitylocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| MILlocation not on record | 1 |
| Universidad del Valle (UniValle)location not on record | 1 |
| MAlocation not on record | 1 |
| Chicago, US | 1 |
| Edinburgh, GB | 1 |
| EL PASO, US | 1 |
| Tempe, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| UnBlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| HUAlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Denver, US | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Sucre, BO | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Denton, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| The University of Arizonalocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Clemson, US | 1 |
| Pomona Collegelocation not on record | 1 |
164 institutions · 2 131 of 2 222 vouchered records shown · 91 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.