Crotalaria pallida
Aiton · speciesAt a glance
Occurrence records5 226
Data sources9
Biological traits55
DNA specimens15
eDNA detections10
Sources9 archives
Databases and archives Crotalaria pallida's data was compiled from.
GBIFGlobal Biodiversity Information Facility5 226 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements4 literature sources55 traits
Chemical compositionNPASS42 compounds
Occurrence & distributionGBIF5 226 records
Environmental DNA1 datasets · 3 countries10 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceGIFT · GoaT · NCBI1.2 Gbp
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology22
Fruit length36 mm
Fruit length max40 mm
Fruit length min35 mm
Fruit width7 mm
Fruit width max10 mm
Fruit width min7 mm
Leaf length57.5 mm
Leaf length max95 mm
Leaf length min20 mm
Leaf width31.5 mm
Leaf width max45 mm
Leaf width min10 mm
Petiole length3.75 cm
Plant height2 m
⚠ sources differ — GIFT: 2 m · AusTraits: 2 m · TRY: 1 m
Plant height max2 m
Plant height min0.1 m
Seed length3.35 mm
Seed length max2.8 mm
Seed mass6.13 mg
⚠ sources differ — TRY: 6.13 mg · GIFT: 9.83 mg
Seed mass max138 mg
Seed mass min4.6 mg
Seed width2.5 mm
Life cycle & reproduction12
Dehiscencedehiscent
Dispersal typeanimal
Flower colouryellow
Flower width max15 mm
Flower width min9 mm
Flowering endApr
Flowering startApr
Flowering timeyyyyyyyyynnn
Life formannual, perennial or subshrub
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual short_lived_perennial · GIFT: perennial
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 850 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Shrub
Habitat GIFTÁrea Antrópica, Campo Limpo, Campo Rupestre, Cerrado (lato sensu), Palmeiral, Restinga, Savana Amazônica
Leaf compoundnesscompound
Leaf shapeelliptical obovate
Succulenceno
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Other traits4
Fruiting endApr
Fruiting startApr
Seeds per fruit11-100
Shoot orientationascending
03Chemical composition42 compounds
Compounds documented for Crotalaria pallida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Spirostane steroids10
Flavanones5
Isoflavones3
Phenanthrenes2
Cholestane steroids2
Documented compounds42 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,4S,13R,16E,19S)-4,15,15,19-tetramethyl-5,20-dioxapentacyclo[17.8.0.04,13.06,11.021,26]heptacosa-6,8,10,16,21,23,25-heptaene | present | NPASS | |
| (1S,2S,4S,5'R,6R,7S,8R,9S,13S,15R,16R,18S)-16-[(2R,3R,4R,5R,6R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3,4-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]oxy-6-(hydroxymethyl)oxan-2-yl]oxy-15-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-11-ene-6,2'-oxane]-10-one | present | NPASS | |
| (1S,2S,4S,5'R,6R,7S,8R,9S,13S,15R,16R,18S)-16-[(2R,3R,4R,5R,6R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-6-(hydroxymethyl)oxan-2-yl]oxy-15-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-11-ene-6,2'-oxane]-10-one | present | NPASS | |
| (1S,2S,4S,5'R,6R,7S,8R,9S,13S,15R,16R,18S)-16-[(2R,3R,4R,5R,6R)-5-[(2S,3R,4S,5R,6R)-4-[(2S,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,4-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-15-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-11-ene-6,2'-oxane]-10-one | present | NPASS | |
| (1S,2S,4S,5'R,6R,7S,8R,9S,13S,16S,18S)-16-[(2R,3R,4R,5R,6R)-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-6-(hydroxymethyl)oxan-2-yl]oxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-11-ene-6,2'-oxane]-10-one | present | NPASS | |
| (2S)-5,7-dihydroxy-6-[[2-hydroxy-5-[(2-hydroxyphenyl)methyl]phenyl]methyl]-8-[(2-hydroxyphenyl)methyl]-2-phenyl-2,3-dihydrochromen-4-one | present | NPASS | |
| (2S)-5,7-dihydroxy-8-[(2-hydroxyphenyl)methyl]-2-phenyl-2,3-dihydrochromen-4-one | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-4,5-dihydroxy-2-[[(1R,2S,4S,6S,7S,8R,9S,12S,13S,15R,16R,18S)-15-hydroxy-6-methoxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-16-yl]oxy]-6-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[(1R,2S,4S,5'R,6R,7S,8R,9S,12S,13S,15R,16R,18S)-15-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-4-hydroxy-2-[[(1R,2S,4S,6S,7S,8R,9S,12S,13S,15R,16R,18S)-15-hydroxy-6-methoxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-16-yl]oxy]-6-(hydroxymethyl)-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS |
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crotalaria pallida has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes6
GenBank sequences10
eDNA detections10
Countries3
The DNA barcodea real sequence read deposited for this species
TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTC …
Crotalaria pallida voucher CTU-CNS MT15 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL6★rbcLa★ITS2★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceGIFT · GoaT · NCBI
The complete instruction manual Crotalaria pallida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 222 500 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Crotalaria pallida1.22 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records14–162n range16median16mode6records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 165×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database — ↗
GIFT · GIFT (floras)
2n 141×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type5 226 records
Wild obs. + sensor2 578
Museum / vouchered2 475
Cultivated / captive11
Other162
Origin
Native14
Introduced450
Range
Area of Occupancy AOO13 436 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 1 350≤1 km 238≤10 km 101>10 km 93
1 782 georeferenced · 796 without coordinates
Open the mapobservation + sensor2 578
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 84≤1 km 43≤10 km 113>10 km 42
282 georeferenced · 2 193 without coordinates
Open the institutions mapphysical evidence2 475
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 11 records without
Open the mapnot free-living11
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions94 of 219 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 129 |
| UNESP-ISlocation not on record | 112 |
| Taipei, TW | 91 |
| Saint Louis, US | 89 |
| Guangzhou, CN | 87 |
| Xiamen, CN | 77 |
| Paris, FR | 70 |
| Kew, GB | 62 |
| Beijing, CN | 58 |
| Universidad Nacional de Colombia (UNAL)location not on record | 44 |
| Universidad de Antioquia (UdeA)location not on record | 40 |
| Jena Microbial Resource Collectionlocation not on record | 39 |
| Istituto Agrario Castelnuovolocation not on record | 37 |
| Smithfield, AU | 34 |
| Porto Alegre, BR | 32 |
| University of Stellenboschlocation not on record | 30 |
| MeiseBGlocation not on record | 29 |
| UFMSlocation not on record | 28 |
| Durango, MX | 27 |
| Salvador, BR | 24 |
| Miami, US | 22 |
| Chaguaramas, TT | 21 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 21 |
| UEMlocation not on record | 20 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 20 |
| Guilin, CN | 20 |
| Shanghai, CN | 19 |
| Masindi, UG | 18 |
| Kunming, CN | 18 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 18 |
| JBRJlocation not on record | 17 |
| BISHlocation not on record | 17 |
| Laboratorio de Ictiologialocation not on record | 17 |
| HNBlocation not on record | 16 |
| Nanjing, CN | 15 |
| UNICAMPlocation not on record | 15 |
| Honolulu, US | 15 |
| Brisbane, AU | 14 |
| UFBAlocation not on record | 14 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 14 |
| Mexico City, MX | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 13 |
| Guangzhou, CN | 13 |
| UFESlocation not on record | 13 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 13 |
| Universidad de Caldas (UCaldas)location not on record | 12 |
| Palmerston, AU | 12 |
| UNESP-FCAlocation not on record | 11 |
| Federal University of Espírito Santolocation not on record | 11 |
| Maringá, BR | 10 |
| Universidade Federal de Sergipe (UFS)location not on record | 10 |
| CASlocation not on record | 10 |
| Universidade Federal do Vale do São Franciscolocation not on record | 10 |
| Departamento de Sistematica e Ecologialocation not on record | 10 |
| UNIVASFlocation not on record | 10 |
| Instituto de Investigação Científica Tropicallocation not on record | 9 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 9 |
| UTFPR-CPlocation not on record | 9 |
| Taipei, TW | 9 |
| USP-IBlocation not on record | 8 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 8 |
| Antiguo Cuscatlán, SV | 8 |
| Mount Annan, AU | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 7 |
| EL PASO, US | 7 |
| UnBlocation not on record | 7 |
| Cenargenlocation not on record | 7 |
| Yaoundé, CM | 6 |
| UEPAlocation not on record | 6 |
| Berlin, DE | 6 |
| Canberra, AU | 5 |
| Blumenau, BR | 5 |
| Chengdu, CN | 5 |
| Culiacán, MX | 5 |
| UFPElocation not on record | 5 |
| Brasília, BR | 5 |
| Fortaleza, BR | 5 |
| Auckland, NZ | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| UFRPElocation not on record | 4 |
| FJIDClocation not on record | 4 |
| HUAlocation not on record | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 4 |
| Universidad del Valle (UniValle)location not on record | 4 |
| Tampa, US | 4 |
| Edinburgh, GB | 4 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 4 |
| CEPLAClocation not on record | 4 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| Universidad de los Llanos (UniLlanos)location not on record | 4 |
| HUENFlocation not on record | 4 |
| Campo Mourão, BR | 3 |
| SCAUlocation not on record | 3 |
| Taipei, TW | 3 |
| Monastir, TN | 3 |
| TAIElocation not on record | 3 |
| Moscow State Universitylocation not on record | 3 |
| Chicago, US | 3 |
| UNESClocation not on record | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| UFERSAlocation not on record | 3 |
| Universidade Federal do Maranhãolocation not on record | 3 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 3 |
| H. Balslevlocation not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| Pondicherry, IN | 2 |
| South Kensington, GB | 2 |
| Fort Worth, US | 2 |
| UFRRJlocation not on record | 2 |
| Pretoria, ZA | 2 |
| Stockholm, SE | 2 |
| Jataí / Setor Industrial, BR | 2 |
| UFMGlocation not on record | 2 |
| Universidade Federal do Espírito Santolocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Chengdu, CN | 2 |
| Christchurch, NZ | 2 |
| Universidad de los Andes (UniAndes)location not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| HACAMlocation not on record | 2 |
| Hangzhou, CN | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| CPATSAlocation not on record | 2 |
| MAlocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Durham, US | 2 |
| UNESP-RClocation not on record | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Sucre, BO | 2 |
| San José, CR | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Bogotá, D.C., CO | 2 |
| Cascavel, BR | 2 |
| Frankfurt am Main | 2 |
| Plocation not on record | 2 |
| Ilhéus, BR | 2 |
| Londrina, BR | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Austin, US | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Montpellier, FR | 1 |
| Claremont, US | 1 |
| LGlocation not on record | 1 |
| Cusco, PE | 1 |
| Paleontological Collectionlocation not on record | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Chapingo, MX | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| UFSClocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Wuzhou, CN | 1 |
| Ivano-Frankivsk, UA | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| IPA/SPlocation not on record | 1 |
| WAGlocation not on record | 1 |
| La Paz, BO | 1 |
| QCNElocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Millersville, US | 1 |
| Tapachula, MX | 1 |
| CJBGlocation not on record | 1 |
| MEDELlocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Corrientes, AR | 1 |
| UEMAlocation not on record | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| IECOSlocation not on record | 1 |
| INMAlocation not on record | 1 |
| UNICENTRO-IRATIlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Zapopan, MX | 1 |
| Nanjing, CN | 1 |
| Philadelphia, US | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| Campo Grande, BR | 1 |
| Seropédica, BR | 1 |
| Cruz das Almas, BR | 1 |
| FUNEDlocation not on record | 1 |
| TNMlocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Kensington, AU | 1 |
| Zürich, CH | 1 |
| National Museum of Natural Sciencelocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Toronto, CA | 1 |
| Brasília, BR | 1 |
| Foz do Iguaçu, BR | 1 |
| Criciúma, BR | 1 |
| Changsha, CN | 1 |
| Cuiabá, BR | 1 |
| St. Augustine, TT | 1 |
| Feira de Santana, BR | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| LDlocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| Guatemala City, GT | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Provo, US | 1 |
| Guiyang, CN | 1 |
| Seoul, KR | 1 |
| ASUlocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Wlocation not on record | 1 |
219 institutions · 2 073 of 2 475 vouchered records shown · 398 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Crotalaria pallida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.4 °C 17.8–25.2
Seasonal swing summer↔winter21.4 °C
Max temp (day)24.6 °C 22.7–30.5
Min temp (night)15.5 °C 13.4–19.9
Precipitation79.6 mm/mo 62.8–109
Air humidity59.2 % 52.0–59.5
Moisture balance-54.3 mm/mo -61.2–-17.8
Vapour deficit910 Pa 856–1,616
Wind speed3.40 m/s 1.80–3.50
Cloud cover39.7 % 25.2–40.1
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.