Crotalaria juncea
speciesAt a glance
Occurrence records1 350
Data sources12
Biological traits117
DNA specimens17
eDNA detections10
Sources12 archives
Databases and archives Crotalaria juncea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 350 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources117 traits
Chemical compositionLOTUS24 compounds
Occurrence & distributionGBIF1 350 records
Environmental DNA1 datasets · 4 countries10 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB · GoaT1.2 Gbp
01Narrative
Crotalaria juncea est une espèce de plantes à fleurs de la famille des Fabaceae, plus communément appelée Chanvre indien, Chanvre brun, Chanvre sunn ou encore Chanvre de Mandras. C'est une plante tropicale asiatique. Le chanvre peut être utilisé comme engrais vert, biocarburant, fourrage et comme fibres pour faire des cordages, dans une région tropicale ou subtropicale. L'espèce peut résister à la sécheresse et se plaît dans les régions chaudes. Ses feuilles sont allongées et alternées, et la fleur est de couleur jaune.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology15
Fruit length32.5 mm
Leaf length47.5 mm
Leaf length max65 mm
Leaf length min30 mm
Leaf width3.5 mm
Leaf width max5 mm
Leaf width min2 mm
Petiole length0.25 cm
Plant height1.6 m
⚠ sources differ — GIFT: 1.6 m · AusTraits: 2 m · USDA: 1.52 m · TRY: 1.52 m
Plant height max3 m
Plant height min1 m
Seed length3.5 mm
Seed mass34.13 mg
Seed mass max58 mg
Seed mass min1.6 mg
Life cycle & reproduction31
After harvest regrowth rateModerate
Bloom periodIndeterminate
Coppice potentialNo
Dehiscencedehiscent
Flower colouryellow
Flower conspicuousYes
Flowering timennyyyyyynnnn
Fruit seed period beginYear Round
Fruit seed period endYear Round
Growth rate USDARapid
Life formannual
Life spanannual
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Resprouting capacityresprouts
Seed spread rateSlow
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment30
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubtropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typelegume
Growth formherb
Growth form USDASingle Crown
Habitat GIFTÁrea Antrópica, Campo de Várzea, Campo Limpo, Campo Rupestre, Cerrado (lato sensu), Manguezal
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapelinear narrowly_oblong
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min16 in
Shape and orientationProstrate
Small grainNo
Woodinessnon-woody
Physiology & chemistry21
Anaerobic toleranceMedium
C:N ratioLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantYes
Fire toleranceNone
Frost free days min360 days
Moisture useHigh
Nitrogen fixation levelHigh
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max169 in
Precipitation min20 in
Protein potentialHigh
Salinity toleranceNone
Shade toleranceHigh
Soil pH max8.4 pH
Soil pH min5 pH
Temperature min32 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound15 000 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
03Chemical composition24 compounds
Compounds documented for Crotalaria juncea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Pyrrolizidine alkaloids8
Pterocarpan5
Flavones3
Flavanones2
Aminoacids2
Documented compounds24 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S,3R)-3-hydroxy-2-(methylamino)pentanoic acid | present | LOTUS | |
| (2S,3S,4R,5S,6R)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,5S)-2-amino-5-hydroxyhexanoic acid | present | LOTUS | |
| (S)-Naringenin | present | LOTUS | |
| 1-(16-Hydroxy-6,11,19-trioxapentacyclo[10.8.0.02,10.05,9.013,18]icosa-2(10),3,5(9),7,13(18),14,16-heptaen-7-yl)ethanone | present | LOTUS | |
| 1-[(1R,12R)-1,16-dihydroxy-6,11,19-trioxapentacyclo[10.8.0.02,10.05,9.013,18]icosa-2(10),3,5(9),7,13(18),14,16-heptaen-7-yl]ethanone | present | LOTUS | |
| 1-[(1S,12S)-1,16-dihydroxy-6,11,19-trioxapentacyclo[10.8.0.02,10.05,9.013,18]icosa-2(10),3,5(9),7,13(18),14,16-heptaen-7-yl]ethanone | present | LOTUS | |
| 2-(16-Hydroxy-6,11,19-trioxapentacyclo[10.8.0.02,10.05,9.013,18]icosa-2(10),3,5(9),7,13(18),14,16-heptaen-7-yl)propane-1,2-diol | present | LOTUS | |
| 3-[(3S,5R,8R,9S,10S,13S)-10,13-dimethyl-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-2,3,4,5,6,7,8,9,11,12-decahydro-1H-cyclopenta[a]phenanthren-17-yl]-2H-furan-5-one | present | LOTUS | |
| 4,5-Dihydroxy-3,4,5-trimethyl-4,5,8,10,12,13,13a,13b-octahydro-2H-[1,6]dioxacycloundecino[2,3,4-gh]pyrrolizine-2,6(3H)-dione | present | LOTUS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crotalaria juncea has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes6
GenBank sequences10
eDNA detections10
Countries4
The DNA barcodea real sequence read deposited for this species
ATCATTGTCGAAGCCTCGCAAGCAGTGCGACCCCGTGGATTTGTTTTGACATGTGAGGGATGGCTAGAGGTGTTCTCGTCCTCGGTCCCC …
Crotalaria juncea voucher S. Subramaniam, A.K.Pandey 1026-1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Crotalaria juncea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 173 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Crotalaria juncea1.17 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records8–162n range16median16mode36records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1634×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +6
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Nadkarni, R. S. 1982. Karyotypic studies in Crotalaria medicaginea var. luxurians Baker and C. juncea Linn. Chromosome Inf. Serv. 32: 4–6.
CCDB · ipcn-api-dl — Dnyansagar, V. R. & R. S. Nadkarni. 1983. Induced tetraploidy in Crotalaria juncea Linn. Cytologia 48: 483–489.
CCDB · ipcn-api-dl — Shibata, K. 1962. Estudios citologicos de plantas colombianas silvestres y cultivadas. J. Agric. Sci. (Tokyo). 8: 49–62.
CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.
CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.
CCDB · ipcn-api-dl — Zhu, B. c. 1984. Karyotype analysis of Sunn crotalarias chromosome. Chin. Bull. Bot. 2: 39–40.
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · ipcn-api-dl — Mangotra, R. & A. K. Koul. 1991. Base number in genus Crotalaria---evidences from meiosis. Nucleus (Calcutta) 34: 158–161.
CCDB · ipcn-api-dl — Kar, K. & S. SEN. 1991. A comparative karyological study of root and embryo tissue of a few genera of Leguminosae. Cytologia 56: 403–408.
CCDB · ipcn-api-dl — de Olivera, A. L. P. C. & M. L. R. d. Aguiar-Perecin. 1999. Karyotype evolution in the genus Crotalaria (Leguminosae). Cytologia 64: 165–174.
CCDB · ipcn-api-dl — Koul, K. K., R. Nagpal & A. Sharma. 2000. Temperature influenced variation in the chromosomal behaviour of male and female sex cells in Sunn hemp (Crotalaria juncea Linn., Fabaceae). Caryologia 53: 113–120.
CCDB · ipcn-api-dl — BHATT, R. P. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · ipcn-api-dl — BHAUMIK, G. H. 1975. Chromosome studies of some Indian species of Crotalaria. Sci. & Cult. 41: 521–523.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.
CCDB · ipcn-api-dl — Gupta, R. & P. K. GUPTA. 1978. Karyotypic studies in the genus Crotalaria L. Cytologia 43: 357–369.
CCDB · ipcn-api-dl — Gupta, R. & P. K. GUPTA. 1978a. Pachytene karyotypes in the genus Crotalaria L. (Leguminosae). Cytologia 43: 655–663.
CCDB · book-ipcn67-71 — DATTA, R. M., & P K. GANGULY. 1967. Karyotype study in the genus Crotalaria 1. Broteria 36: 39-46.
CCDB · book-ipcn75-78 — Gupta & Gupta 1978a
CCDB · book-ipcn75-78 — Gupta & Gupta 1978
CCDB · book-ipcn75-78 — Bir & Kumari 1977
CCDB · book-ipcn75-78 — Bhatt 1976
CCDB · book-ipcn75-78 — Bhaumik 1975
CCDB · book-ipcn73-74 — BHATT, R.P. 1974. Studies on the flora in north Gujarat. III Cytolog I Nucleus 17: 33-39. !
CCDB · book-fedorov — BpeCJiaBe~ 11 AP 1933, 1934
CCDB · book-fedorov — Ramanujam et al.1933
CCDB · book-fedorov — D. 1955)
CCDB · book-fedorov — Banerji L., Samai 1936
CCDB · book-fedorov — Datta R. M., Biswas 1962
CCDB · book-fedorov — Shibata 1962b
CCDB · book-fedorov — Magoon et al. 1963
CCDB · book-atlas-flowering-plants — Ramanujam et al. '33 FoMaT
CCDB · kew — Gupta PK. 1976. Nuclear DNA, nuclear area and nuclear dry mass in 13 species of Crotalaria (Angiospermae, Leguminosae). Chromosoma 54: 155-164.
CCDB · Cave1963 — Shibata 1962
2n 81×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Verma, R. C. & S. N. Raina. 1978. Cytogenetics of Crotalaria. Cell Chromosome Newslett. 1: 32–33.
2n 141×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Verma, R. C. & S. N. Raina. 1991. Differential cytomorphological responses of Crotalaria species to colchitetraploidy. Phytomorphology 41: 21–33.
n 811×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1
CCDB · ipcn-api-dl — Dnyansagar, V. R. & R. S. Nadkarni. 1983. Induced tetraploidy in Crotalaria juncea Linn. Cytologia 48: 483–489.
CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.
CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.
CCDB · ipcn-api-dl — Jahan, B., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in some taxa of Fabaceae mostly native to Pakistan. Ann. Missouri Bot. Gard. 81: 792–799.
CCDB · ipcn-api-dl — BHAUMIK, G. H. 1975. Chromosome studies of some Indian species of Crotalaria. Sci. & Cult. 41: 521–523.
CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.
CCDB · book-ipcn67-71 — GUPTA, P.K . & R. GUPTA. 1971. In IOPB chromosome number reports XXXII. Taxon 20: 349-356:"
CCDB · book-ipcn75-78 — Bir & Kumari 1977
CCDB · book-ipcn75-78 — Bhaumik 1975
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · Cave1962 — Datta & Biswas 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type1 350 records
Wild obs. + sensor595
Museum / vouchered710
Cultivated / captive3
Other42
Origin
Native26
Introduced55
Range
Area of Occupancy AOO3 692 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy80% within 1 km
≤100 m 265≤1 km 39≤10 km 38>10 km 37
379 georeferenced · 216 without coordinates
Open the mapobservation + sensor595
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 127≤1 km 33≤10 km 130>10 km 68
358 georeferenced · 352 without coordinates
Open the institutions mapphysical evidence710
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 2 without coordinates
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions58 of 114 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 141 |
| Museo Entomologico de Leonlocation not on record | 61 |
| Palmerston, AU | 36 |
| Canberra, AU | 34 |
| Kensington, AU | 27 |
| Xiamen, CN | 24 |
| Mount Annan, AU | 14 |
| Salvador, BR | 14 |
| Taipei, TW | 13 |
| University of Stellenboschlocation not on record | 13 |
| Bando, JP | 11 |
| Istituto Agrario Castelnuovolocation not on record | 10 |
| Smithfield, AU | 10 |
| Beijing, CN | 10 |
| Kew, GB | 9 |
| Porto Alegre, BR | 9 |
| Guangzhou, CN | 9 |
| Baroda, IN | 7 |
| UNICAMPlocation not on record | 7 |
| Saint Louis, US | 7 |
| Paris, FR | 6 |
| Tsukuba, JP | 6 |
| UFBAlocation not on record | 6 |
| Nanjing, CN | 5 |
| Wuhan, CN | 5 |
| Odawara, JP | 4 |
| Seoul, KR | 4 |
| Chengdu, CN | 4 |
| Guilin, CN | 4 |
| Pondicherry, IN | 4 |
| LDlocation not on record | 4 |
| Universidad Nacional de Colombia (UNAL)location not on record | 4 |
| Tampa, US | 4 |
| Pretoria, ZA | 4 |
| James Cook Townsvillelocation not on record | 4 |
| Instituto de Investigação Científica Tropicallocation not on record | 4 |
| Kochi, JP | 4 |
| St. Augustine, TT | 4 |
| Bronx, US | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Jiangxi Universitylocation not on record | 3 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 3 |
| Nishihara, JP | 3 |
| Université du Lomélocation not on record | 3 |
| Yunnan Universitylocation not on record | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| UFMSlocation not on record | 3 |
| Yangling, CN | 2 |
| Brasília, BR | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| Adelaide, AU | 2 |
| Durban, ZA | 2 |
| Cenargenlocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| TAIElocation not on record | 2 |
| Taipei, TW | 2 |
| FUNEDlocation not on record | 2 |
| South Kensington, GB | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Urumqi, CN | 2 |
| MeiseBGlocation not on record | 2 |
| Tomioka, JP | 2 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Kunming, CN | 1 |
| JBRJlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Sagamihara, JP | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| San Diego, US | 1 |
| Feira de Santana, BR | 1 |
| Anhui Normal Universitylocation not on record | 1 |
| Claremont, US | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Ann Arbor, US | 1 |
| Moscow State Universitylocation not on record | 1 |
| University of Johannesburg Herbariumlocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| BClocation not on record | 1 |
| Cambridge, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| CICYTEXlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Awka, NG | 1 |
| nlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| SNJB's KKHA Arts, SMGL Commerce & SPHJ Science College Chandwad, Dist. Nashik, Maharashtra, India. 423101.location not on record | 1 |
| HNBlocation not on record | 1 |
| Xining, CN | 1 |
| Honolulu, US | 1 |
| Tamil Nadu Agricultural Universitylocation not on record | 1 |
| Chiba, JP | 1 |
| WAGlocation not on record | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| Kingston, US | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Nishihara, JP | 1 |
| Armidale, AU | 1 |
| Campo Mourão, BR | 1 |
| Uppsala University Herbariumlocation not on record | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| BISHlocation not on record | 1 |
| Paleontological Collectionlocation not on record | 1 |
| Cape Town, ZA | 1 |
| Cuiabá, BR | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Taipei, TW | 1 |
| HUENFlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| CASlocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
114 institutions · 657 of 710 vouchered records shown · 52 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Crotalaria juncea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map4 countries0
mixed soil with gravel on scraped roadsideCultivated Habitat
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.7 °C 16.9–28.5
Seasonal swing summer↔winter16.5 °C
Max temp (day)29.7 °C 21.2–34.2
Min temp (night)19.3 °C 12.5–23.1
Precipitation103 mm/mo 39.4–146
Air humidity52.0 % 46.7–66.4
Moisture balance-17.8 mm/mo -123–16.2
Vapour deficit1,434 Pa 727–2,203
Wind speed2.50 m/s 1.80–3.30
Cloud cover25.2 % 17.6–33.0
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.