Crotalaria incana
speciesAt a glance
Occurrence records3 456
Data sources15
Biological traits44
DNA specimens39
eDNA detections16
Sources15 archives
Databases and archives Crotalaria incana's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 456 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics39 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources44 traits
Chemical compositionLOTUS · NPASS11 compounds
Occurrence & distributionGBIF3 456 records
Environmental DNA1 datasets · 6 countries16 detections
DNA & barcodingBOLD · NCBI39 specimens
Genome at a glanceCCDB · GIFT · GoaT1.7 Gbp
01Narrative
Crotalaria incana, la Crotalaire effilée ou chanvre du Bengale, est une espèce de plantes à fleurs dicotylédones de la famille des Fabaceae, sous-famille des Faboideae, originaire des régions tropicales. Ce sont des plantes herbacées annuelles ou des sous-arbrisseaux pouvant atteindre 1,30 mètre de haut, généralement avec des branches étalées. La plante est parfois récoltée dans la nature pour un usage local en médecine traditionnelle. Elle est parfois cultivée comme engrais vert dans les plantations de caféiers. Cette plante contient notamment des alcaloïdes pyrrolizidiniques.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology19
Fruit length30 mm
Fruit length max39 mm
Fruit length min28 mm
Leaf length45 mm
Leaf length max70 mm
Leaf length min4 mm
Leaf width27.5 mm
Leaf width max45 mm
Leaf width min6 mm
Petiole length3.5 cm
Plant height2 m
⚠ sources differ — AusTraits: 2 m · TRY: 2.5 m
Plant height max3 m
Plant height min0.25 m
Seed length2.25 mm
Seed length max3 mm
Seed length min1.8 mm
Seed mass7.12 mg
⚠ sources differ — TRY: 7.12 mg · AusTraits: 6.75 mg · GIFT: 7.28 mg
Seed mass max13.5 mg
Seed mass min3.8 mg
Life cycle & reproduction7
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — AusTraits: barochory · GIFT: unspecialized
Flowering timeyyyyynnnnnny
Life formannual, perennial or subshrub
Life spanperennial
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 600 m
Elevation mean400 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: shrub · TRY: Herb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Limpo, Campo Rupestre, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Restinga
Leaf compoundnesscompound
Leaf shapewidely_elliptical widely_obovate
Mycorrhiza type0.000000000000943
Succulenceno
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: woody · GIFT: variable
Physiology & chemistry1
Photosynthetic pathwayC3
03Chemical composition11 compounds
Compounds documented for Crotalaria incana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Pyrrolizidine alkaloids5
Cardenolides1
Cholestane steroids $ Ecdysteroids1
Documented compounds11 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,4Z,6R,7S,16S,17S)-4-ethylidene-7,16-dihydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| (3S,5S,9S,10S,13R,14R,17R)-3,9-dihydroxy-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,5,9,11,12,13,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-6(10H)-one | present | NPASS | |
| 10,22-dihydroxy-7,18-dimethyl-9-oxo-19-(5-oxo-2H-furan-3-yl)-4,6,11-trioxahexacyclo[12.11.0.03,12.05,10.015,23.018,22]pentacosane-14-carbaldehyde | present | NPASS | |
| 4-Ethylidene-7,16-dihydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| 4-Ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| 4-Ethylidene-7-hydroxy-7-(hydroxymethyl)-6-methyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadec-11-ene-3,8-dione | present | LOTUS | |
| BCJMNZRQJAVDLD-FSUHMXNKSA-N | present | NPASS | |
| BDHCXPWIDHVEQN-HNENSFHCSA-N | present | NPASS | |
| HKODIGSRFALUTA-PKCCZVHDSA-N | present | NPASS | |
| Integerrimine | present | LOTUS |
05DNA & barcoding39 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crotalaria incana has left across the world's sequence archives.
At a glance
DNA specimens39
Marker genes7
GenBank sequences10
eDNA detections16
Countries6
The DNA barcodea real sequence read deposited for this species
ATCATTGTCGAAGCCTCACAAGCAGTGCGACCCGCGAATTTGTTTGACGTGTGAGGGATGGCTAGAAGGTGCTCGGCTCCTTGGTCACCC …
Crotalaria incana voucher S. Subramaniam, B. Subramaniam & A. K. Pandey 1008 (DUH, M) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL3★rbcLa★trnL-F★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Crotalaria incana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 662 600 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Crotalaria incana1.66 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–162n range14median14mode41records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1439×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +6
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Patil, B. C. 1983. Cytomixis in Crotalaria Linn. J. Cytol. Genet. 18: 79–85.
CCDB · ipcn-api-dl — Shibata, K. 1962. Estudios citologicos de plantas colombianas silvestres y cultivadas. J. Agric. Sci. (Tokyo). 8: 49–62.
CCDB · ipcn-api-dl — Verma, R. C. & S. N. Raina. 1983. Cytogenetics of Crotalaria VIII. Male meiosis in 26 species. Cytologia 48: 719–733.
CCDB · ipcn-api-dl — Oliveira, A. L. P. C. d. & M. L. R. d. Aguiar-Perecin. 1989. Estudos citogenéticos em 5 espécies do g@6enero Crotalaria (Leguminosae). Ci. & Cult. (Sao Paulo) 41: 678.
CCDB · ipcn-api-dl — Custódio, A. V. d. C., M. A. d. Alves, E. d. Nunes & F. E. B. Silva. 1989. Número cromossómico de seis espécies de leguminosas do Ceará. Ci. & Cult. 41: 684.
CCDB · ipcn-api-dl — Palomino, G. & R. Vázquez. 1991. Cytogenetic studies in Mexican populations of species of Crotalaria L. (Leguminosae---Papilionoideae). Cytologia 56: 343–351.
CCDB · ipcn-api-dl — de Olivera, A. L. P. C. & M. L. R. d. Aguiar-Perecin. 1999. Karyotype evolution in the genus Crotalaria (Leguminosae). Cytologia 64: 165–174.
CCDB · ipcn-api-dl — Molero, J., A. Rovira, J. Simón, R. Duré & D. Franco. 2002. IOPB chromosome data 18. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 34: 22–24.
CCDB · ipcn-api-dl — Patil, B. C. & M. S. Chennaveeraiah. 1975. Cytological studies in Crotalaria incana L. and C. mucronata Desv. Nucleus 18: 141–146.
CCDB · ipcn-api-dl — Fernandez, A. 1977. Numeros cromosomicos en Angiospermas. Hickenia 1: 83–86.
CCDB · ipcn-api-dl — Gupta, R. & P. K. GUPTA. 1978. Karyotypic studies in the genus Crotalaria L. Cytologia 43: 357–369.
CCDB · ipcn-api-dl — Gupta, R. & P. K. GUPTA. 1978a. Pachytene karyotypes in the genus Crotalaria L. (Leguminosae). Cytologia 43: 655–663.
CCDB · ipcn-api-dl — Flores, A. S. 2006. Chromosome numbers in Brazilian species of Crotalaria (Leguminosae, Papilionoideae) and their taxonomic significance. Bot. J. Linn. Soc. 151: 271–277.
CCDB · ipcn-api-dl — Almada, R. D. 2006. Karyotype analysis and chromosome evolution in southernmost South American species of Crotalaria (Leguminosae). Bot. J. Linn. Soc. 150: 329–341.
CCDB · book-ipcn67-71 — BOULTER, D., E. DERBY, J.A. SRAHM-LELIVELD, & R.M. POLHILL. 1970. Observations on the cytology and seed-proteins of various African species of Crotalaria L. (Leguminosae). New Phytol. 69: 117-131.
CCDB · book-ipcn75-78 — Gupta & Gupta 1978a
CCDB · book-ipcn75-78 — Gupta & Gupta 1978
CCDB · book-ipcn75-78 — Fernandez 1977
CCDB · book-ipcn75-78 — Patil & Chennaveeraiah 1975
CCDB · book-fedorov — Senn 1938b
CCDB · book-fedorov — Atchison 1950
CCDB · book-fedorov — Rao Y. S. 1943, 1950a
CCDB · book-fedorov — Krapovickas A., Krapovickas A. M. F. 1957
CCDB · book-fedorov — Shibata 1962b
CCDB · book-fedorov — Magoon et al. 1963
CCDB · kew — Gupta PK. 1976. Nuclear DNA, nuclear area and nuclear dry mass in 13 species of Crotalaria (Angiospermae, Leguminosae). Chromosoma 54: 155-164.
CCDB · Cave1957 — Krapov. & Fuchs de K.
CCDB · Cave1963 — Magoon et al. 1963; Shibata 1962
GIFT · GIFT (floras)
2n 162×CCDB · ipcn-api-dl · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Mangotra, R. & A. K. Koul. 1991. Base number in genus Crotalaria---evidences from meiosis. Nucleus (Calcutta) 34: 158–161.
GIFT · GIFT (floras)
n 78×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Patil, B. C. 1983. Cytomixis in Crotalaria Linn. J. Cytol. Genet. 18: 79–85.
CCDB · ipcn-api-dl — Verma, R. C. & S. N. Raina. 1983. Cytogenetics of Crotalaria VIII. Male meiosis in 26 species. Cytologia 48: 719–733.
CCDB · ipcn-api-dl — Palomino, G. & R. Vázquez. 1991. Cytogenetic studies in Mexican populations of species of Crotalaria L. (Leguminosae---Papilionoideae). Cytologia 56: 343–351.
CCDB · ipcn-api-dl — Bernardello, L. M., L. B. Stiefkens & M. A. Piovano. 1990. Números cromosómicos en dicotiledóneas Argentinas. Bol. Soc. Argent. Bot. 26: 149–157.
CCDB · ipcn-api-dl — Almada, R. D. 2006. Karyotype analysis and chromosome evolution in southernmost South American species of Crotalaria (Leguminosae). Bot. J. Linn. Soc. 150: 329–341.
CCDB · book-ipcn67-71 — HSU, C.-C. 1968. Preliminary chromosome studies on the vascular plants of Taiwan (II). Taiwania No. 14: 11-27.
CCDB · book-ipcn73-74 — CHENNAVEERAIAH, M.S., & B.C. PATIL. 1973. Chromosome number and karyotype study in eight species of Crotalaria. Cytologia 38: 73-79.
CCDB · book-ipcn73-74 — CHENNAVEERAIAH, M.S., B.C. PATIL. 1972. Chromosome number in the genus Crotalaria Linn. Proc. Indian Sci. Congr. Assoc. 59(III): 351- 352.
n 84×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Gupta, R. & P. K. GUPTA. 1978a. Pachytene karyotypes in the genus Crotalaria L. (Leguminosae). Cytologia 43: 655–663.
CCDB · book-ipcn75-78 — Gupta & Gupta 1978a
CCDB · book-ipcn75-78 — Gupta & Gupta 1978b
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~7.98 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin7.98 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type3 456 records
Wild obs. + sensor641
Museum / vouchered2 699
Cultivated / captive23
Other93
Origin
Native379
Introduced55
Range
Area of Occupancy AOO8 620 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 287≤1 km 79≤10 km 19>10 km 34
419 georeferenced · 222 without coordinates
Open the mapobservation + sensor641
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy75% within 1 km
≤100 m 448≤1 km 48≤10 km 117>10 km 52
665 georeferenced · 2 034 without coordinates
Open the institutions mapphysical evidence2 699
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 22 without coordinates
Open the mapnot free-living23
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions112 of 240 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 375 |
| Saint Louis, US | 297 |
| Bronx, US | 112 |
| Mexico City, MX | 78 |
| Kew, GB | 66 |
| Universidad Nacional de Colombia (UNAL)location not on record | 53 |
| UFMSlocation not on record | 52 |
| University of Stellenboschlocation not on record | 51 |
| Austin, US | 50 |
| Taipei, TW | 50 |
| San Isidro, AR | 49 |
| Corrientes, AR | 46 |
| Laboratorio de Ictiologialocation not on record | 35 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 33 |
| Tampa, US | 32 |
| Porto Alegre, BR | 31 |
| UNICAMPlocation not on record | 30 |
| Ann Arbor, US | 27 |
| Córdoba, AR | 26 |
| Paleontological Collectionlocation not on record | 24 |
| Chapingo, MX | 24 |
| Miami, US | 24 |
| Salvador, BR | 22 |
| Cenargenlocation not on record | 20 |
| Arusha, TZ | 20 |
| Brasília, BR | 20 |
| Universidad de Caldas (UCaldas)location not on record | 19 |
| Istituto Agrario Castelnuovolocation not on record | 17 |
| Universidad Nacional de Asunciónlocation not on record | 17 |
| Castelar, AR | 17 |
| Chaguaramas, TT | 17 |
| Riverside, US | 16 |
| Altos de Pipe, VE | 15 |
| Culiacán, MX | 15 |
| Museo Entomologico de Leonlocation not on record | 15 |
| UFBAlocation not on record | 14 |
| Mérida, MX | 14 |
| Masindi, UG | 14 |
| San Diego, US | 14 |
| Maringá, BR | 14 |
| Chicago, US | 13 |
| UnBlocation not on record | 13 |
| UNIVASFlocation not on record | 13 |
| CASlocation not on record | 13 |
| Universidad Industrial de Santander (UIS)location not on record | 12 |
| Universidade Federal de Sergipe (UFS)location not on record | 12 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 12 |
| LDlocation not on record | 11 |
| South Kensington, GB | 11 |
| JBRJlocation not on record | 10 |
| Xiamen, CN | 9 |
| Austin, US | 8 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 8 |
| La Paz, MX | 8 |
| Chongqing Museumlocation not on record | 8 |
| UFESlocation not on record | 8 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 8 |
| Jena Microbial Resource Collectionlocation not on record | 8 |
| Puerto Ayora, EC | 8 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 7 |
| Santa Teresa, BR | 7 |
| Departamento de Sistematica e Ecologialocation not on record | 7 |
| Honolulu, US | 7 |
| INMAlocation not on record | 7 |
| UFERSAlocation not on record | 7 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 7 |
| Universidade Federale do Rio Grande do Sullocation not on record | 7 |
| Tapachula, MX | 7 |
| BISHlocation not on record | 7 |
| Brasília, BR | 7 |
| Cambridge, US | 6 |
| Feira de Santana, BR | 6 |
| Edinburgh, GB | 6 |
| USP-IBlocation not on record | 6 |
| UFRPElocation not on record | 6 |
| Bloomington, US | 6 |
| UEMlocation not on record | 6 |
| TAIElocation not on record | 6 |
| Area de Conservacion Guanacastelocation not on record | 6 |
| CEPLAClocation not on record | 6 |
| Universidad de Antioquia (UdeA)location not on record | 6 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 6 |
| CPATSAlocation not on record | 6 |
| Loja, EC | 6 |
| TAFORI-LSRClocation not on record | 6 |
| Tlalnepantla, MX | 6 |
| Universidade Federal do Vale do São Franciscolocation not on record | 6 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 5 |
| Antiguo Cuscatlán, SV | 5 |
| Beijing, CN | 5 |
| UNESP-ISlocation not on record | 5 |
| National Biodiversity Institute, Costa Ricalocation not on record | 5 |
| Smithfield, AU | 5 |
| Palmerston, AU | 5 |
| Fortaleza, BR | 5 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 5 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 5 |
| Cusco, PE | 4 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 4 |
| Fundación Miguel Lillolocation not on record | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| León, NI | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| Guasave, MX | 4 |
| Moscow State Universitylocation not on record | 4 |
| CJBGlocation not on record | 4 |
| ASUlocation not on record | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| Federal University of Espírito Santolocation not on record | 4 |
| MEXUlocation not on record | 4 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| EL PASO, US | 3 |
| Elocation not on record | 3 |
| Barcelona, ES | 3 |
| Guatemala City, GT | 3 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| MAlocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Puebla, MX | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 3 |
| Mexico City, MX | 3 |
| Fredericksburg, US | 3 |
| Aarhus, DK | 3 |
| University of Zhejianglocation not on record | 3 |
| Mazatlán, MX | 3 |
| Blumenau, BR | 2 |
| Linares, MX | 2 |
| Santiago de Cali, CO | 2 |
| Bogotá, D.C., CO | 2 |
| Taipei, TW | 2 |
| Leiden University Medical Centerlocation not on record | 2 |
| La Paz, BO | 2 |
| San José, CR | 2 |
| UNESP-FCAlocation not on record | 2 |
| Canberra, AU | 2 |
| MeiseBGlocation not on record | 2 |
| Brisbane, AU | 2 |
| UFPRlocation not on record | 2 |
| Montréal, CA | 2 |
| Cruz das Almas, BR | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Paris, FR | 2 |
| Lima, PE | 2 |
| UFMGlocation not on record | 2 |
| UNESP-RClocation not on record | 2 |
| Mérida, MX | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| Riobamba, EC | 2 |
| NO DISPONIBLElocation not on record | 2 |
| Sangmiung Universitylocation not on record | 2 |
| Bangkok, TH | 2 |
| Mount Annan, AU | 2 |
| UERJlocation not on record | 2 |
| Sucre, BO | 2 |
| UNESClocation not on record | 2 |
| Ilhéus, BR | 2 |
| Wlocation not on record | 2 |
| Nishihara, JP | 2 |
| INTAlocation not on record | 2 |
| Guangzhou, CN | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| Bergen, NO | 2 |
| BAlocation not on record | 2 |
| UFOPlocation not on record | 2 |
| Pittsburg, US | 1 |
| Podgorica, ME | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Tempe, US | 1 |
| FAVElocation not on record | 1 |
| Frankfurt am Main | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Berlin, DE | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Cochabamba, BO | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| UFABClocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Londrina, BR | 1 |
| TNMlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Flagstaff, US | 1 |
| Glocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Universidad Nacional de Córdobalocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Criciúma, BR | 1 |
| Toronto, CA | 1 |
| Emporia, US | 1 |
| Ensenada, MX | 1 |
| Ciudad de México, MX | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Taipei, TW | 1 |
| UFPElocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Southwest Forestry Collegelocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Uppsala, SE | 1 |
| Burlington, US | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| BMlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| HUAlocation not on record | 1 |
| Universidad del Valle (UniValle)location not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Museum of Zoologylocation not on record | 1 |
| Pondicherry, IN | 1 |
| Phoenix, US | 1 |
| Santa Barbara, US | 1 |
| Foz do Iguaçu, BR | 1 |
| FUNEDlocation not on record | 1 |
| MUFALlocation not on record | 1 |
| Dekalb, US | 1 |
| Knoxville, US | 1 |
| CRSN_LWIROlocation not on record | 1 |
| Cuiabá, BR | 1 |
| Mississippi State, US | 1 |
| Stockholm, SE | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| UNEMATlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| HACAMlocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Boise, US | 1 |
| QCNElocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| UESBlocation not on record | 1 |
| Claremont, US | 1 |
| URCAlocation not on record | 1 |
| OTSlocation not on record | 1 |
240 institutions · 2 544 of 2 699 vouchered records shown · 155 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Crotalaria incana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map6 countries0
Red soil savanna bushland.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.7 °C 18.2–25.2
Seasonal swing summer↔winter2.60 °C
Max temp (day)26.4 °C 23.2–28.0
Min temp (night)20.1 °C 13.2–23.0
Precipitation55.0 mm/mo 4.90–104
Air humidity60.2 % 54.4–65.6
Moisture balance-66.0 mm/mo -151–-28.2
Vapour deficit999 Pa 897–1,227
Wind speed3.30 m/s 2.00–5.70
Cloud cover23.6 % 15.2–38.8
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.