Crotalaria burhia

Buch.-Ham. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Crotalaria

At a glance

Occurrence records159

Data sources9

Biological traits12

DNA specimens8

eDNA detections4

Sources9 archives

Databases and archives Crotalaria burhia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility159 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF159 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Crotalaria burhia là một loài thực vật có hoa trong họ Đậu. Loài này được Benth. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.83 mg

Seed mass max4.83 mg

Seed mass min4.83 mg

Life cycle & reproduction4

Dispersal typewind

Life formsubshrub or perennial

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment2

Climatesubtropical

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crotalaria burhia has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences10

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMG270137.1 ↗345 bpPakistan · 2013

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATC …

Crotalaria burhia isolate DBMPP110-14 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★rbcLa★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crotalaria burhia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records8–162n range16median16mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 167×CCDB · book-ipcn66 · CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · book-ipcn66 — Datta & Choudhury 1966

CCDB · book-indian_vol1 — Ramanathan, K. 1955b ; Malik, C.P 1960b ; Magoon, M.L. et al. 1963 ; Datta, R.M. & Choudhury, P .C. 1964-1965b, 1966 ; Baquar, S.R. eta!. 1965 ; Raina, S.N. & Verma, R.C. 1979; Verma, R.C. & Raina, S.N. 1980

CCDB · book-fedorov — Ramanathan 1955b

CCDB · book-fedorov — Malik C. P. 1960b

CCDB · book-fedorov — Magoon et al. 1963

CCDB · book-fedorov — Baquar et al. 1965

CCDB · book-fedorov — Datta R. M., Choudhury 1966

2n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Verma, R. C. & S. N. Raina. 1978. Cytogenetics of Crotalaria. Cell Chromosome Newslett. 1: 32–33.

n 85×CCDB · book-ipcn65 · CCDB · ipcn-api-dl

CCDB · book-ipcn65 — Baquar et al. 1965

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1982. Chromosome numbers of some plants of Pakistan. Pakistan J. Bot. 14: 117–129.

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1991. Chromosome numbers in subfamily Papilionoideae (Leguminosae) from Pakistan. Willdenowia 20: 159–165.

CCDB · ipcn-api-dl — Jahan, B., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in some taxa of Fabaceae mostly native to Pakistan. Ann. Missouri Bot. Gard. 81: 792–799.

CCDB · ipcn-api-dl — Raina, S. & R. C. Verma. 1979. Cytogenetics of Crotalaria I. Mitotic complements in twenty species of Crotalaria L. Cytologia 44: 365–375.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type159 records

Wild obs. + sensor119

Museum / vouchered40

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 6≤10 km 1

7 georeferenced · 112 without coordinates

Open the mapobservation + sensor119

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 4≤10 km 20>10 km 3

27 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
QAUlocation not on record	27
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	1
University of Guelph, OAC Herbariumlocation not on record	1
LDlocation not on record	1

4 institutions · 30 of 40 vouchered records shown · 9 without an institution code

09Environmental DNA4 detections

Where the DNA of Crotalaria burhia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 24.3–29.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)30.5 °C 29.5–35.7

Min temp (night)19.3 °C 18.3–21.2

Precipitation12.0 mm/mo 9.00–89.4

Air humidity48.4 % 41.7–51.3

Moisture balance-108 mm/mo -182–-35.8

Vapour deficit1,616 Pa 1,558–2,395

Wind speed2.70 m/s 2.00–3.40

Cloud cover25.2 % 21.0–30.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)