Crotalaria barbata

Graham ex Wight & Arn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Crotalaria

At a glance

Occurrence records2

Data sources10

Biological traits3

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Crotalaria barbata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Chemical compositionLOTUS · NPASS35 compounds

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Crotalaria barbata là một loài thực vật có hoa trong họ Đậu. Loài này được Wight & Arn. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formannual, perennial or subshrub

Habitat & environment1

Climateseasonally dry tropical

Other traits1

Plant support typefree-standing

03Chemical composition35 compounds

Compounds documented for Crotalaria barbata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids10

Guaiane sesquiterpenoids4

Pterocarpan1

Cholestane steroids $ Stigmastane steroids1

Ursane and Taraxastane triterpenoids1

Documented compounds35 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Alpinetin	present	NPASS
(-)-Kaur-16-en-19-oic acid	present	NPASS
(1R,2R,3R,6S,8S,10R)-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione	present	NPASS
(1R,2R,3R,6S,8S,10R,11R,12R)-11,12-dihydroxy-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione	present	NPASS
(1R,2R,3R,6S,8S,10R,12R)-12-hydroxy-3,8-dimethyl-5,9,15-trioxatetracyclo[11.2.1.02,6.08,10]hexadec-13(16)-ene-4,14-dione	present	NPASS
(1R,5R,6S,16R)-6-hydroxy-5,6-dimethyl-2,8-dioxa-13-azatricyclo[8.5.1.013,16]hexadec-10-ene-3,7-dione	present	LOTUS
(1R,7S,12R)-7-prop-1-en-2-yl-6,11,19-trioxapentacyclo[10.8.0.02,10.05,9.013,18]icosa-2(10),3,5(9),13(18),14,16-hexaen-16-ol	present	LOTUS
(1R,9S,11S,15R,16S)-9-methyl-14-methylidene-2,6,12-trioxatetracyclo[7.6.1.04,16.011,15]hexadeca-4,7-diene-3,13-dione	present	NPASS
(1S,3S,7R,8R,12S,14S,16R)-16-hydroxy-14-methyl-9-methylidene-2,6,11,17-tetraoxapentacyclo[12.2.1.03,7.07,16.08,12]heptadecane-5,10-dione	present	NPASS
(1S,3S,7R,8R,9R,12S,14S,16R)-16-hydroxy-9,14-dimethyl-2,6,11,17-tetraoxapentacyclo[12.2.1.03,7.07,16.08,12]heptadecane-5,10-dione	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crotalaria barbata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX371671.1 ↗746 bpIndia

ACGT

CCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTCGCAAGAAGTGCG …

Crotalaria barbata voucher Hohenacker sn M-0242309 (M) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crotalaria barbata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Mohandas, A. & P. I. Kuriachan. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 269.

CCDB · book-indian_vol1 — Mohandas, A. & Kuriachan, P.I. 1979

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	1
Pondicherry, IN	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Crotalaria barbata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)