Crossostephium chinense

(L.) Makino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Crossostephium

At a glance

Occurrence records631

Data sources11

Biological traits6

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Crossostephium chinense's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility631 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS51 compounds

Occurrence & distributionGBIF631 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Crossostephium is a monotypic genus of flowering plants in the daisy family.Lessing, Christian Friedrich. 1831. Linnaea 6: 220-221. in LatinTropicos, Crossostephium Less. The only species is Crossostephium chinense native to parts of Japan (Kazan-retto, Nansei-shoto), Taiwan, Guangdong, Indochina, Peninsular Malaysia, and the Philippines.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Life cycle & reproduction2

Life spanperennial

Raunkiær life formchamaephyte

Habitat & environment4

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

03Chemical composition51 compounds

Compounds documented for Crossostephium chinense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Steroidal alkaloids16

Taraxerane triterpenoids4

Flavonols3

Flavones3

Piperidine alkaloids $ Steroidal alkaloids3

Documented compounds51 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,6S,9S,10S,11R,12S,14S,15S,20S,23R,24S)-6,10,23-trimethyl-4-azahexacyclo[12.11.0.02,11.04,9.015,24.018,23]pentacos-17-ene-10,12,20-triol	present	NPASS
(1R,3R,8S,9S,10R,13S,14S,17R)-10,13-dimethyl-17-[(1S)-1-[(3S)-3-methyl-2,3,4,5-tetrahydropyridin-6-yl]ethyl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-1,3-diol	present	NPASS
(3S,8R,9S,10R,12S,13S,14S,17R)-10,13-dimethyl-17-[(1S)-1-[(3S)-3-methyl-2,3,4,5-tetrahydropyridin-6-yl]ethyl]-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-3,12-diol	present	NPASS
(4,4,6a,6a,8a,11,11,14b-Octamethyl-1,2,3,4a,5,6,8,9,10,12,12a,13,14,14a-tetradecahydropicen-3-yl) acetate	present	LOTUS
2-(3,4-dimethoxyphenyl)-5,7-dihydroxy-3-[(2R,3R,4S,5R,6R)-4,5,6-trihydroxy-3-methyloxan-2-yl]oxychromen-4-one	present	NPASS
2-(3,4-dimethoxyphenyl)-5-hydroxy-3-methoxy-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
3-Veratroylzygadenine	present	NPASS
[(1S,2S,6S,9R,10S,11R,12R,13S,14S,15R,16R,18S,19S,22S,23S,25R)-10,12,14,16,23-pentahydroxy-6,10,19-trimethyl-22-[(2R)-2-methylbutanoyl]oxy-24-oxa-4-azaheptacyclo[12.12.0.02,11.04,9.015,25.018,23.019,25]hexacosan-13-yl] (2S)-2-hydroxy-2-methylbutanoate	present	NPASS
[(1S,2S,6S,9S,10S,11R,12R,13S,14S,15S,16R,18S,19S,22S,23S,25R)-10,12,14,16,22,23-hexahydroxy-6,10,19-trimethyl-24-oxa-4-azaheptacyclo[12.12.0.02,11.04,9.015,25.018,23.019,25]hexacosan-13-yl] (2R)-2-methylbutanoate	present	NPASS
[(1S,2S,6S,9S,10S,11R,12R,13S,14S,15S,16R,18S,19S,22S,23S,25R)-10,12,14,16,23-pentahydroxy-6,10,19-trimethyl-13-[(2R)-2-methylbutanoyl]oxy-24-oxa-4-azaheptacyclo[12.12.0.02,11.04,9.015,25.018,23.019,25]hexacosan-22-yl] (2S)-2-hydroxy-2-methylbutanoate	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crossostephium chinense has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW545683.1 ↗239 bp

ACGT

AGCAGAACGACCCGTGAACACGTAAAAACAACCGAGTGTTGATTGGATCAAGCGCTTGTTTGATCCTCTCGACGCTTCGTCGATGTGCAT …

Crossostephium chinense isolate Cch internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crossostephium chinense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.

CCDB · ipcn-api-dl — Suzuki, R., K. Kondo & C. Peng. 2001. Chromosome studies in chrysanthemum flora of Taiwan 2. Ajania pacifica (Nakai) Bremer et Humphries dwarf form, Crossostephium chinense (L.) Makino, Dendranthema arisanse (Hayata) Ling et Shih, D. indica (L.) Des Moul. and D. lavandulifolia (Fishch. ex Trautv.) Ling et Shih var. tomentellum (Hand.-Mazz.) Ling et Shih. Chromosome Sci. 5: 57–61.

CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.

CCDB · book-ipcn67-71 — MIYAGI, C. 1971. Chromosome numbers in sperrnatophytes from Okinawa Islands (1). Biol. Mag. Okinawa 8: 14-23.

CCDB · eflora

08Occurrence & distribution

Record type631 records

Wild obs. + sensor504

Museum / vouchered116

Other11

Origin

Native3

Range

Area of Occupancy AOO1 924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 74≤1 km 34≤10 km 6>10 km 372

486 georeferenced · 18 without coordinates

Open the mapobservation + sensor504

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 2≤10 km 40

42 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	40
Taipei, TW	19
Nishihara, JP	16
Nishihara, JP	5
Museo Athanasius Kircher di Romalocation not on record	4
Taipei, TW	4
Taipei, TW	4
TAIElocation not on record	3
Odawara, JP	2
Xiamen, CN	2
Nagano City, JP	2
Hangzhou, CN	1
Zhejiang Universitylocation not on record	1
Kunming, CN	1
FJIDClocation not on record	1
Guilin, CN	1
Beijing, CN	1
Pondicherry, IN	1
Nagasaki University - Fisherieslocation not on record	1
Nanjing, CN	1
Saint Louis, US	1
Sanda, JP	1
Zhejiang Museum of Natural Historylocation not on record	1
Guangzhou, CN	1
Wuhan, CN	1
Bangkok, TH	1

26 institutions · 116 of 116 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Crossostephium chinense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)