Crossopetalum ilicifolium

(Poir.) Kuntze · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Crossopetalum

At a glance

Occurrence records243

Data sources8

Biological traits9

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Crossopetalum ilicifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Crossopetalum ilicifolium, commonly known as Christmasberry, is a species of plant in the family Celastraceae. It is found in USA (Florida), Haiti, Dominican Republic, Bahamas, and Cuba.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crossopetalum ilicifolium has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLKJ773410.1 ↗1 300 bp

ACGT

CGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCGGCGGTAGCTGC …

Crossopetalum ilicifolium ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1

plant barcode

08Occurrence & distribution

Record type243 records

Wild obs. + sensor191

Museum / vouchered52

Range

Area of Occupancy AOO524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 89≤1 km 6≤10 km 1>10 km 68

164 georeferenced · 27 without coordinates

Open the mapobservation + sensor191

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 2≤10 km 6>10 km 24

32 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	25
Jena Microbial Resource Collectionlocation not on record	6
Chapel Hill, US	5
Saint Louis, US	4
Bronx, US	2
Wuzhou, CN	2
Burlington, US	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Mexico City, MX	1
Tampa, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Bloomington, US	1

12 institutions · 51 of 52 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Crossopetalum ilicifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)