Crocus versicolor

Ker Gawl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records4 749

Data sources10

Biological traits11

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Crocus versicolor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 749 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF4 749 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Шафра́н (кро́кус) разноцве́тный — вид однодольных растений рода Шафран (Crocus) семейства Ирисовые (Iridaceae). Впервые описан британским ботаником Джоном Белленденом Кер Голером в 1808 году.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height0.1 m

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Crocus versicolor across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
kaempferol 3-O-sophoroside		present	LOTUS
Quercetin		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus versicolor has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE801142.1 ↗636 bpItaly

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTACATCCTCAACTCACTACTCCGTCCCGTCCCGCCGCCTCAATATGCGGCGCGGC …

Crocus versicolor genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher GAT:7270

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus versicolor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · book-ipcn73-74 · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn73-74 — BRIGHTON, C., B. MATHEW, & C.J. MARCHANT. 1973. Chromosome counts in the genus Crocus. Kew Bull. 28: 451-464.

CCDB · book-atlas-flowering-plants — Mather 1932

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.776 ↗

08Occurrence & distribution

Record type4 749 records

Wild obs. + sensor4 570

Museum / vouchered178

Cultivated / captive1

Range

Area of Occupancy AOO4 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy19% within 1 km

≤100 m 657≤1 km 81≤10 km 3 186>10 km 45

3 969 georeferenced · 601 without coordinates

Open the mapobservation + sensor4 570

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤1 km 3≤10 km 24

29 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence178

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	124
BIO-UNIPIlocation not on record	11
MHNAIXlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
MAlocation not on record	1
Boumlocation not on record	1
College Park, US	1
Oskarshamn, SE	1
Bourges, FR	1
Muséum Henri Lecoqlocation not on record	1
Wlocation not on record	1

12 institutions · 148 of 178 vouchered records shown · 30 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Crocus versicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crocus versicolor

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction3

Diet & foraging1

Habitat & environment5

Other traits1

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 749 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type4 749 records