Crocus tommasinianus

Herb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records23 358

Data sources12

Biological traits23

DNA specimens7

eDNA detections5

Sources12 archives

Databases and archives Crocus tommasinianus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility23 358 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF23 358 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · NCBI2.6 Gbp

01Narrative

Crocus tommasinianus, the woodland crocus, early crocus, or Tommasini's crocus, was named after the botanist Muzio G. Spirito de Tommasini (1794-1879). It is native to Bulgaria, Hungary, Albania, and the former Yugoslavia. It is often referred to as the early or snow crocus, but these terms are shared with several other species, although C. tommasinianus is amongst the first to bloom. Multiple plants are often called tommies in the horticultural trade.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology3

Plant height0.2 m

Plant height max0.2 m

Plant height min0.1 m

Life cycle & reproduction10

Dehiscencedehiscent

Dispersal typeanimal

Flowering endMar

Flowering startDec

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualabsent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Crocus tommasinianus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Miscellaneous apocarotenoids2

Apocarotenoids (β-)1

Megastigmanes1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Crocetin	present	LOTUS
Crocin	present	LOTUS
Picrocrocin	present	LOTUS
Safranal	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus tommasinianus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences6

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSHG518177.1 ↗634 bp

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTACATCCTTACTTACTACTTCGTCTCGTCTCGCCGCTCCTCGTGGCGTGGCGTGG …

Crocus tommasinianus genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher BEOU:31678, isolate 31678

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Crocus tommasinianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 581 920 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Crocus tommasinianus2.58 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 166×CCDB · nw-europe-fl · CCDB · fl-europaea · CCDB · book-ipcn67-71 +1

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4871

CCDB · fl-europaea — Sus*nik & Lovka,

CCDB · book-ipcn67-71 — SARMA, Y. S. R. K., & RAMJEE. 1967. A new chromosome number in Nitella tenuissima (Desv. J Kutz. em. R. D. w. Caryologia 20: 61-63.

CCDB · book-atlas-flowering-plants — Mather 1932

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.803 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.3% BUSCO

08Occurrence & distribution

Record type23 358 records

Wild obs. + sensor22 910

Museum / vouchered401

Cultivated / captive6

Other41

Origin

Native1

Introduced907

Range

Area of Occupancy AOO36 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 7 820≤1 km 2 001≤10 km 10 211>10 km 150

20 182 georeferenced · 2 728 without coordinates

Open the mapobservation + sensor22 910

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 164≤1 km 22≤10 km 7>10 km 4

197 georeferenced · 204 without coordinates

Open the institutions mapphysical evidence401

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 3 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	96
LDlocation not on record	66
Provincia di Livornolocation not on record	31
Oskarshamn, SE	29
BFLlocation not on record	25
DBF-NHMDlocation not on record	22
GJOlocation not on record	11
LfUlocation not on record	9
BIO-UNIPIlocation not on record	9
Dresden, DE	9
Salzburg, AT	7
Bronx, US	6
Mlocation not on record	5
Denver, US	4
Olocation not on record	4
South Kensington, GB	3
MeiseBGlocation not on record	3
Wlocation not on record	3
Frankfurt am Main	2
Christchurch, NZ	2
Kew, GB	2
Fulda, DE	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Vancouver, CA	2
Naturalis Biodiversity Centerlocation not on record	2
Bergen, NO	2
Berlin, DE	2
Stadt Seeland, Ortsteil Gatersleben, DE	2
PrivatHerblocation not on record	1
Corvallis, US	1
H-Schuhwlocation not on record	1
Tilburg, NL	1
Auckland, NZ	1
H-Dunkellocation not on record	1
H-Hohlalocation not on record	1
New Brunswick, US	1
Portland, US	1
Nijmegen, NL	1
Görlitz, DE	1
BRNUlocation not on record	1
BG-NMNHSlocation not on record	1
Trondheim, NO	1
Adam Mickiewicz University in Poznańlocation not on record	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
Edinburgh, GB	1

46 institutions · 380 of 401 vouchered records shown · 21 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Crocus tommasinianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

lawn

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.00 °C 5.10–6.00

Seasonal swing summer↔winter13.6 °C

Max temp (day)8.00 °C 7.60–8.00

Min temp (night)3.90 °C 2.30–3.90

Precipitation68.3 mm/mo 48.6–68.3

Air humidity64.3 % 64.3–65.0

Moisture balance10.8 mm/mo 10.8–18.6

Vapour deficit335 Pa 309–335

Wind speed5.30 m/s 3.50–5.30

Cloud cover49.0 % 49.0–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crocus tommasinianus

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction10

Diet & foraging2

Habitat & environment6

Physiology & chemistry1

Other traits1

Compound class profile3 classes

Documented compounds4 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type23 358 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 46 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type23 358 records