Crocus speciosus

M.Bieb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records2 920

Data sources10

Biological traits16

DNA specimens4

eDNA detections5

Sources10 archives

Databases and archives Crocus speciosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 920 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF2 920 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Шафра́н прекра́сный — клубнелуковичное травянистое многолетнее растение, вид рода Шафран (Crocus) семейства Ирисовые, или Касатиковые (Iridaceae). Встречается в горных лесах в Закавказье, Малой Азии, Крыму, Иране.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.4 m

Plant height min0.1 m

Seed mass3.47 mg

Life cycle & reproduction5

Flowering endOct

Flowering startDec

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Crocus speciosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols4

Miscellaneous apocarotenoids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
1-O-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl] 16-O-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-[[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl] (2E,4E,6E,8E,10E,12E,14E)-2,6,11,15-tetramethylhexadeca-2,4,6,8,10,12,14-heptaenedioate	present	LOTUS
3-((6-Deoxy-2-O-beta-D-glucopyranosyl-alpha-L-mannopyranosyl)oxy)-5,7-dihydroxy-2-(4-hydroxyphenyl)-4H-1-benzopyran-4-one	present	LOTUS
5,7-dihydroxy-3-[(2S,3R,4R,5S,6S)-5-hydroxy-6-methyl-3,4-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]oxy-2-(4-hydroxyphenyl)chromen-4-one	present	LOTUS
5,7-dihydroxy-3-[(2S,3R,4S,5S,6R)-5-hydroxy-6-methyl-4-[(2S,3R,4R,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2R,3S,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-(4-hydroxyphenyl)chromen-4-one	present	LOTUS
5,7-dihydroxy-3-[(2S,3S,4R,5S,6S)-5-hydroxy-6-methyl-4-[(2S,3R,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-(4-hydroxyphenyl)chromen-4-one	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus speciosus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOQ096622.1 ↗694 bp

ACGT

GATCGCGAACGTGTTATATATTTGCTAACCAAAACAACTTCGGTTCGTCCCGTCGCCCCTCGCGGGGCGACGTGGCGAGACGGAGGAAAC …

Crocus speciosus voucher SOA063308 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus speciosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records8–182n range14median14mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Heywood, C. A. 1983. Meiosis in some species and cultivars of Crocus (Iridaceae). Pl. Syst. Evol. 143: 207–225.

CCDB · ipcn-api-dl — Sopova, M. 1972a. The cytology of ten Crocus species from Macedonia. God. Zborn. Biol. Prir.-Mat. Fak. Univ. Kiril & Metodij 24: 73–82.

CCDB · book-ipcn75-78 — Sopova 1972a

2n 182×CCDB · nw-europe-fl · CCDB · ipcn-api-dl

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4882

CCDB · ipcn-api-dl — Phitos, D. & G. Kamari. 1983. Chromosome numbers in Crocus species (Iridaceae) from Greece. Bot. Chron. (Patras) 3: 30–32.

2n 81×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Johnson, M. A. T. & P. E. Brandham. 1997. New chromosome numbers in petaloid monocotyledons and in other miscellaneous angiosperms. Kew Bull. 52(1): 121–138.

2n 121×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ebrahimzadeh, H., A. Saboora, M. R. Noori-Daloii & S. M. Ghaffari. 1998. Chromosomal studies on four Iranian Crocus species (Iridaceae). Iran. J. Bot. 7(2): 179–192.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.895 ↗

08Occurrence & distribution

Record type2 920 records

Wild obs. + sensor2 791

Museum / vouchered119

Cultivated / captive10

Origin

Native3

Introduced95

Range

Area of Occupancy AOO4 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 951≤1 km 206≤10 km 1 193>10 km 18

2 368 georeferenced · 423 without coordinates

Open the mapobservation + sensor2 791

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 24≤1 km 8≤10 km 8>10 km 1

41 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence119

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	24
SLU Artdatabankenlocation not on record	20
LDlocation not on record	15
Stadt Seeland, Ortsteil Gatersleben, DE	8
Oskarshamn, SE	7
BRNUlocation not on record	3
Olocation not on record	3
Denver, US	2
Podgorica, ME	1
Tartu, EE	1
Arcata, US	1
Wlocation not on record	1
Edinburgh, GB	1
Toronto, CA	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

16 institutions · 90 of 119 vouchered records shown · 29 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Crocus speciosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crocus speciosus

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Other traits1

Compound class profile2 classes

Documented compounds5 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 920 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 920 records