Crocus sieberi

J.Gay · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records623

Data sources12

Biological traits13

DNA specimens0

eDNA detections2

Sources12 archives

Databases and archives Crocus sieberi's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility623 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS20 compounds

Occurrence & distributionGBIF623 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Crocus sieberi, Sieber's crocus, also referred to as the Cretan crocus or snow crocus (as is Crocus chrysanthus), is a plant of the genus Crocus in the family Iridaceae. A small, early blooming crocus, it easily naturalises, and is marked by a brilliant orange which is mostly confined to the stamens and style, fading through the bottom third of the tepal. It grows wild generally in the Balkans and Greece, especially in the island Crete. There are four subtypes: sieberi (Crete), atticus (Attica area around Athens), nivalis and sublimis. Its cultivars are used as ornamental plants. Height: 3 -.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.05 m

Seed mass3.6 mg

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition20 compounds

Compounds documented for Crocus sieberi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Plant xanthones6

Anthocyanidins3

Friedelane triterpenoids3

Pyranocoumarins2

Cholestane steroids $ Stigmastane steroids1

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
(10R,11R)-10,11,16,16-tetramethyl-6-phenyl-3,9,15-trioxatetracyclo[12.4.0.02,7.08,13]octadeca-1,5,7,13,17-pentaene-4,12-dione	present	NPASS
(10S,11S)-10,11,16,16-tetramethyl-6-propyl-3,9,15-trioxatetracyclo[12.4.0.02,7.08,13]octadeca-1,5,7,13,17-pentaene-4,12-dione	present	NPASS
(2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[7-hydroxy-3-[(2S,3S,4R,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)chromenylium-5-yl]oxyoxane-3,4,5-triol	present	LOTUS
(2S,3S)-5-hydroxy-2,3,8,8-tetramethyl-6-(1-phenylethenyl)-2,3-dihydropyrano[2,3-h]chromen-4-one	present	NPASS
1,5-Dihydroxyxanthone	present	NPASS
2-(3-Methylbut-2-enyl)-1,3,5-trihydroxyxanthone	present	NPASS
6,8-Dihydroxy-1,1-bis(3-methylbut-2-enyl)-3,4-dihydroxanthene-2,9-dione	present	NPASS
6-Deoxyjacareubin	present	NPASS
Betulinic Acid	present	NPASS
Buchanaxanthone	present	NPASS

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus sieberi has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE663966.1 ↗673 bpGreece

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTATACACCCTCACTCAAGACTCCGCTTCGTCCCGTCGCTCCTCGCGGCGCGGCGT …

Crocus sieberi subsp. sieberi genomic DNA containing ITS1, 5.8S rRNA gene, ITS2, isolate EM220, specimen voucher GAT:7265

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus sieberi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 226×CCDB · nw-europe-fl · CCDB · fl-europaea · CCDB · book-ipcn67-71 +2

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4872

CCDB · fl-europaea — Brighton et al.,

CCDB · book-ipcn67-71 — SARMA, Y. S. R. K., & RAMJEE. 1967. A new chromosome number in Nitella tenuissima (Desv. J Kutz. em. R. D. w. Caryologia 20: 61-63.

CCDB · book-ipcn73-74 — BRIGHTON, C., B. MATHEW, & C.J. MARCHANT. 1973. Chromosome counts in the genus Crocus. Kew Bull. 28: 451-464.

CCDB · book-atlas-flowering-plants — 1932

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.734 ↗

08Occurrence & distribution

Record type623 records

Wild obs. + sensor563

Museum / vouchered51

Cultivated / captive9

Origin

Native5

Introduced28

Range

Area of Occupancy AOO1 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 227≤1 km 34≤10 km 235>10 km 2

498 georeferenced · 65 without coordinates

Open the mapobservation + sensor563

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 16≤1 km 1≤10 km 1>10 km 1

19 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence51

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 6 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	19
SLU Artdatabankenlocation not on record	13
Berlin, DE	3
Copenhagen, DK	2
Ugentlocation not on record	2
Clocation not on record	1
Mlocation not on record	1
Oskarshamn, SE	1
Salzburg, AT	1
GJOlocation not on record	1
Moscow, US	1
Wlocation not on record	1
Bangkok, TH	1
DBF-NHMDlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Edmonton, CA	1

16 institutions · 50 of 51 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Crocus sieberi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)