Crocus reticulatus

Steven ex Adams · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records2 319

Data sources8

Biological traits14

DNA specimens1

eDNA detections2

Sources8 archives

Databases and archives Crocus reticulatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility2 319 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF2 319 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Crocus reticulatus is a species of flowering plant in the genus Crocus of the family Iridaceae. It is a cormous perennial native to central and southern European Russia, the northern Caucasus, the Transcaucasus, and Ukraine. Crocus reticulatus is found growing in woods and meadows at elevations up to 2000 meters, and flowering occurs February though April.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.92 mg

Seed mass max4.92 mg

Seed mass min4.92 mg

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus reticulatus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLM993442.1 ↗660 bp

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTATATATTTGCTAACCAAAACAACTTCGTCTCGTCCCGCCGCCCCTCGCGGCGCG …

Crocus reticulatus genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, isolate MOLD_2_3, specimen voucher GAT 23084

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS9

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus reticulatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records10–142n range12median14mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 123×CCDB · fl-europaea · CCDB · book-ipcn73-74

CCDB · fl-europaea — Brighton et al.,

CCDB · book-ipcn73-74 — BRIGHTON, C., B. MATHEW, & C.J. MARCHANT. 1973. Chromosome counts in the genus Crocus. Kew Bull. 28: 451-464.

CCDB · book-ipcn73-74 — SUSNIK, F., & M. LOVKA. 1973. In IOPB chromosome number reports XLI. Taxon 22: 459-464.

2n 143×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn72

CCDB · ita-fl — CHICHIRICC G., FRIZZI G., TAMMARO F. - 1981 (1979). Numeri cromosomici per la flora italiana:652-661.. Inform. Bot. Ital. , 11(3): 307-314.

CCDB · ipcn-api-dl — Chichiricco, G., G. Frizzi & F. Tammaro. 1979. Numeri cromosomici per la Flora Italiana: 598-601. Inform. Bot. Ital. 11: 3–35.

CCDB · book-ipcn72 — POPOVA, M.T. 1972. In IOPB chromosome number reports XXXV. Taxon 21: 161-166.

2n 101×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.926 ↗

08Occurrence & distribution

Record type2 319 records

Wild obs. + sensor1 844

Museum / vouchered467

Other8

Origin

Introduced1

Range

Area of Occupancy AOO3 660 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 625≤1 km 253≤10 km 124>10 km 53

1 055 georeferenced · 789 without coordinates

Open the mapobservation + sensor1 844

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 81≤1 km 190≤10 km 47>10 km 3

321 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence467

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	42
Moscow State Universitylocation not on record	29
GZUlocation not on record	7
Institut und Museum fuer Geologie und Palaeontologielocation not on record	5
Vitebsk State University named after P.M. Masherovlocation not on record	5
GJOlocation not on record	4
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	3
Stadt Seeland, Ortsteil Gatersleben, DE	2
Adam Mickiewicz University in Poznańlocation not on record	2
Oskarshamn, SE	1
Voronezh State Universitylocation not on record	1
Madison, US	1
ULBF-AGRlocation not on record	1

13 institutions · 103 of 467 vouchered records shown · 364 without an institution code

09Environmental DNA2 detections

Where the DNA of Crocus reticulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crocus reticulatus

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction2

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 319 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 319 records