Crocus pallasii

Goldb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records803

Data sources9

Biological traits16

DNA specimens1

eDNA detections3

Sources9 archives

Databases and archives Crocus pallasii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility803 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF803 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2.9 Gbp

01Narrative

Crocus pallasii is een bolgewas uit de lissenfamilie (Iridaceae). De wetenschappelijke naam werd gepubliceerd door Karl Ludwig Goldbach in 1817.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.16 m

Plant height min0.08 m

Life cycle & reproduction5

Flowering endNov

Flowering startSep

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest edges, hills, saline places, steppe, stony places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus pallasii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSLS398403.1 ↗640 bpMacedonia

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTACACCATACTTACTTACTTACGACTCCGTCCCGTCCCGTCGCCCCCCGCGGCGT …

Crocus pallasii genomic DNA sequence contains ITS1, 5.8S rRNA gene, ITS2, strain cr796, specimen voucher Nis

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus pallasii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 912 044 897 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Crocus pallasii2.91 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–162n range14median14mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 146×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-fedorov +1

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Mathew, B., C. A. BRIGHTON & T. Baytop. 1979. Taxonomic and cytological notes on Asiatic Crocus. Notes Roy. Bot. Gard. Edinburgh 37: 469–473.

CCDB · book-ipcn67-71 — ZAKHARYEVA O.I., & L.M. MAKUSHENKO. 1969. Chromosome numbers of monocotyledons belonging to the families Liliaceae, Iridaceae, Amaryllidaceae, Araceae. Bot. Zurn. 54: 1213-1227.

CCDB · book-fedorov — Feinbrun 1958.b

CCDB · Cave1958 — Feinbrun 1958b

2n 151×CCDB · book-fedorov

CCDB · book-fedorov — Pathak 1940b

2n 161×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Sopova 1972a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.894 ↗

08Occurrence & distribution

Record type803 records

Wild obs. + sensor765

Museum / vouchered32

Cultivated / captive6

Origin

Native5

Range

Area of Occupancy AOO1 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 313≤1 km 47≤10 km 49>10 km 13

422 georeferenced · 343 without coordinates

Open the mapobservation + sensor765

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤1 km 5≤10 km 2>10 km 1

8 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence32

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	8
Stadt Seeland, Ortsteil Gatersleben, DE	5
Rishon Le Zion, IL	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

4 institutions · 15 of 32 vouchered records shown · 17 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Crocus pallasii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)