Crocus ochroleucus

Boiss. & Gaill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records324

Data sources11

Biological traits10

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Crocus ochroleucus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility324 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF324 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 10

01Narrative

Crocus ochroleucus is species of flowering plant in the Iridaceae family. It is a cream-colored crocus native to Lebanon, Palestine and Syria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus ochroleucus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE801132.1 ↗656 bpIsrael

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTACACCCTCACTTACTTACGACTCCGTTTCGTCCCGTCGCACCTCGCGGCGCGGC …

Crocus ochroleucus genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher GAT:7228

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus ochroleucus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidydiploid inferred

Chromosome records10–102n range10median10mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 104×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-atlas-flowering-plants +1

CCDB · ipcn-api-dl

CCDB · book-ipcn73-74 — BRIGHTON, C., B. MATHEW, & C.J. MARCHANT. 1973. Chromosome counts in the genus Crocus. Kew Bull. 28: 451-464.

CCDB · book-atlas-flowering-plants — Mather 1932

CCDB · Cave1958 — Feinbrun 1958b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.894 ↗

08Occurrence & distribution

Record type324 records

Wild obs. + sensor319

Museum / vouchered5

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 67≤1 km 11≤10 km 15>10 km 1

94 georeferenced · 225 without coordinates

Open the mapobservation + sensor319

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	3
Rishon Le Zion, IL	1
Provincia di Livornolocation not on record	1

3 institutions · 5 of 5 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Crocus ochroleucus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)