Crocus nevadensis

Amo & Campo · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records942

Data sources11

Biological traits9

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Crocus nevadensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility942 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF942 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Crocus nevadensis is a species of Crocus from North Africa and Spain. It is found growing in mountain meadows, scree, scrub, and open pine forests at altitudes that range from 1000 to 3000 meters; flowers occur in February to April. Plants have fimbriate, white stigmas, and the petals are sometime not marked - especially for plants found around the Sierra de Cazorla region. Under cultivation the plants are very susceptible to infections by botrytis, which attacks the faded flowers and can move into the corm and kill it.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus nevadensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE663959.1 ↗627 bpSpain

ACGT

TCGAGACCCGAACAAACGGACGACCGCGAACGTGTTACATACATATCCTCTACTTACGACTCCGCATCGTCCCGCCGCTCCTCGCGGCGC …

Crocus nevadensis genomic DNA containing ITS1, 5.8S rRNA gene, ITS2, isolate DB 7174, specimen voucher B:10 0011868

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus nevadensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records26–302n range28median30mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 266×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +2

CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).

CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 77-83. Montserrat Mart, J. M.Anales Jard. Bot. Madrid38(1): 249-252(1982).

CCDB · fl-europaea — Rejon, 1974

CCDB · ipcn-api-dl — Montserrat Marti, J. M. 1981. Números cromosomáticos de plantas occidentales, 77-83. Anales Jard. Bot. Madrid 38: 249–252.

CCDB · book-ipcn73-74 — RUIZ REJON, M. In IOPB chromosome number reports XLVI. Taxon 23: 801- 812.

CCDB · CromoCat 2015 — Ruíz Rejón, M. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 805-806.

2n 306×CCDB · iber-fl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015

CCDB · iber-fl — Chromosome counts in the genus Crocus (Iridaceae). Brighton, C. A., B. Mathew & C. J. Marchant.Kew Bull.28(3): 451-464(1973).

CCDB · iber-fl — Recherches sur les liens de parent entre la flore orophile des Alpes et celledes Pyrnes. Kpfer, P.Boissiera23: 3-322(1974).

CCDB · book-ipcn73-74 — KUPFER, P. 1974. Recherches sur les liens de parente entre la flore orophile des Alpes et celle des Pyrenees. Boissiera 23: 1-322.

CCDB · CromoCat 2015 — Brighton, C. A., Mathew, B. & Marchant, C. J. (1973). Chromosome counts in the genus Crocus (Iridaceae). Kew Bull. 28(3): 451-464.

CCDB · CromoCat 2015 — Küpfer, P. (1974). Recherches sur les liens de parenté entre la flore orophile des Alpes et celle des Pyrénées. Boissiera 23: 3- 322.

CCDB · CromoCat 2015 — Ruíz Rejón, M. (1976b). Estudios cariológicos en especies españolas del orden Liliales. II. Familia Iridaceae. Cuad. Ci. Biol. 5: 141-144.

2n 282×CCDB · iber-fl · CCDB · CromoCat 2015

CCDB · iber-fl — Chromosome counts in the genus Crocus (Iridaceae). Brighton, C. A., B. Mathew & C. J. Marchant.Kew Bull.28(3): 451-464(1973).

CCDB · CromoCat 2015 — Brighton, C. A., Mathew, B. & Marchant, C. J. (1973). Chromosome counts in the genus Crocus (Iridaceae). Kew Bull. 28(3): 451-464.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.326 ↗

08Occurrence & distribution

Record type942 records

Wild obs. + sensor730

Museum / vouchered168

Cultivated / captive1

Other43

Origin

Native37

Range

Area of Occupancy AOO1 892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 80≤1 km 244≤10 km 190>10 km 12

526 georeferenced · 204 without coordinates

Open the mapobservation + sensor730

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 10≤1 km 68≤10 km 24

102 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence168

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	38
Granada, ES	24
València, ES	16
Madrid, ES	12
Jaén, ES	12
Pamplona, ES	9
Barcelona, ES	8
Museo della Bonifica di San Donà di Piavelocation not on record	7
BDBClocation not on record	6
Vitoria, ES	6
Salamanca, ES	4
BClocation not on record	4
College of the Atlantic, Museumlocation not on record	4
Entomological Society of Latvialocation not on record	3
Museo Achille Folettolocation not on record	3
Universidad del Pais Vasco (UPV/EHU)location not on record	2
Alicante, ES	2
Wlocation not on record	2
Córdoba, ES	2
Phyletisches Museum Jenalocation not on record	1
IPE-CSIClocation not on record	1
Arequipa, PE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

23 institutions · 168 of 168 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Crocus nevadensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)