Crocus minimus

Redouté · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records79

Data sources7

Biological traits9

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Crocus minimus's data was compiled from.

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources9 traits

Chemical compositionNPASS46 compounds

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition46 compounds

Compounds documented for Crocus minimus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones7

Cinnamic acids and derivatives6

Simple phenolic acids6

Flavonols5

Flavanones3

Documented compounds46 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid	present	NPASS
(2R,3R,4S,5S,6R)-2-[(1R,2S)-3-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-2-[4-[(E)-3-hydroxyprop-1-enyl]-2,6-dimethoxyphenoxy]propoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S)-5,7,3',4'-Tetrahydroxyflavanone 6-C-glucoside	present	NPASS
(Z)-3-phenyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyprop-2-enoic acid	present	NPASS
3,5-Dihydroxybenzoic acid	present	NPASS
4-Hydroxybenzoic acid	present	NPASS
Aesculetin	present	NPASS
AKGDIVKDYFDRLS-VJCFOKSDSA-N	present	NPASS
Aspalathin	present	NPASS
Catechin	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus minimus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE801140.1 ↗648 bpItaly

ACGT

TCGAGACCCGAACGAACGGACGACCGCGAACGTGTTACATCCCTACCCGCTCTCCGTCCCGTCCCGCCGCTCCTCGCGGCGCGGCGCGAC …

Crocus minimus genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher GAT:7260

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type79 records

Wild obs. + sensor68

Museum / vouchered11

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 33≤1 km 10≤10 km 4>10 km 2

49 georeferenced · 19 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CJBGlocation not on record	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
MAlocation not on record	1
Oskarshamn, SE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Bourges, FR	1

6 institutions · 11 of 11 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Crocus minimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)