Crocus kotschyanus

K.Koch · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records439

Data sources8

Biological traits12

DNA specimens1

eDNA detections3

Sources8 archives

Databases and archives Crocus kotschyanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility439 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF439 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 8

01Narrative

Шафра́н Кочи — клубнелуковичное травянистое многолетнее растение, вид рода Шафран (Crocus) семейства Ирисовые, или Касатиковые (Iridaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.08 m

Plant height min0.05 m

Life cycle & reproduction3

Flowering startDec

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus kotschyanus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE664000.1 ↗648 bpTurkey

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTACACCCTTACTTACTTACGACTCCGTTTCGTCCCGTCGCACCTCGCGGCGTGGC …

Crocus kotschyanus genomic DNA containing ITS1, 5.8S rRNA gene, ITS2, isolate HKEP1031, specimen voucher GAT:7156

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus kotschyanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 81×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.951 ↗

08Occurrence & distribution

Record type439 records

Wild obs. + sensor413

Museum / vouchered26

Origin

Introduced12

Range

Area of Occupancy AOO804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 172≤1 km 21≤10 km 158>10 km 7

358 georeferenced · 55 without coordinates

Open the mapobservation + sensor413

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 7

7 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	5
Boise, US	4
Corvallis, US	4
Claremont, US	2
LDlocation not on record	2
WTUlocation not on record	1
Oskarshamn, SE	1
Knoxville, US	1
Minia, EG	1
Pullman, US	1
DBF-NHMDlocation not on record	1

11 institutions · 23 of 26 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Crocus kotschyanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)