Crocus imperati

Ten. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records117

Data sources11

Biological traits10

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Crocus imperati's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility117 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF117 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Crocus imperati là một loài thực vật có hoa trong họ Diên vĩ. Loài này được Ten. miêu tả khoa học đầu tiên năm 1826.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Crocus imperati across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Disaccharides $ Polysaccharides1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
WURCS=2.0/1,3,2/(a2122h-1b_1-5)/1-1-1/a6-b1_b4-c1		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus imperati has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE801131.1 ↗635 bpItaly

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTACATCCTTACTTACCACTCCGTCCCGTCCCGCCGCTCCTCGCGGCGCGGCGCGG …

Crocus imperati genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher GAT:7221

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus imperati carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records16–262n range26median26mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 269×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-fedorov +1

CCDB · ita-fl — MATHER K. - 1932. Chromosome variation in Crocus I.. J. Genetics , 26: 129-142.

CCDB · ita-fl — BRIGHTON C.A., MATHEW B., MARCHANT C.J. - 1973. Chromosome counts in the genus Crocus (Iridaceae).. Kew. Bull. , 28(3): 451-464.

CCDB · ipcn-api-dl — Heywood, C. A. 1983. Meiosis in some species and cultivars of Crocus (Iridaceae). Pl. Syst. Evol. 143: 207–225.

CCDB · book-fedorov — Mather L.g32

CCDB · book-fedorov — Brittingham 1934

CCDB · book-fedorov — Karasawa 1937

CCDB · book-atlas-flowering-plants

2n 161×CCDB · book-fedorov

CCDB · book-fedorov — Nakajima 1936

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.602 ↗

08Occurrence & distribution

Record type117 records

Wild obs. + sensor66

Museum / vouchered51

Origin

Introduced1

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 28≤1 km 11≤10 km 2

41 georeferenced · 25 without coordinates

Open the mapobservation + sensor66

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence51

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	29
Institut und Museum fuer Geologie und Palaeontologielocation not on record	15
BIO-UNIPIlocation not on record	4
Oskarshamn, SE	1
Wlocation not on record	1
GZUlocation not on record	1

6 institutions · 51 of 51 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Crocus imperati was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)