Crocus hadriaticus

Herb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records43

Data sources11

Biological traits12

DNA specimens6

eDNA detections3

Sources11 archives

Databases and archives Crocus hadriaticus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Crocus hadriaticus is a species of flowering plant in the genus Crocus of the family Iridaceae. It is a cormous perennial with three subspecies native to Greece.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.09 m

Seed mass15 mg

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus hadriaticus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE801174.1 ↗630 bpGreece

ACGT

CCGAGACCCGAACGAACGGACGATCGCGAACGTGTTACACCATACTTACTTACCTACGACTCCGTTCCGCCCCGTCGCTCCTCGCGGCGT …

Crocus hadriaticus genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher StH 1532

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus hadriaticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–242n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Phitos, D. & G. Kamari. 1983. Chromosome numbers in Crocus species (Iridaceae) from Greece. Bot. Chron. (Patras) 3: 30–32.

CCDB · ipcn-api-dl — Heywood, C. A. 1983. Meiosis in some species and cultivars of Crocus (Iridaceae). Pl. Syst. Evol. 143: 207–225.

CCDB · book-fedorov — Mather 1932

CCDB · book-atlas-flowering-plants — Mather 1932

2n 242×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Karasawa 1943

CCDB · book-atlas-flowering-plants — Karasawa

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.854 ↗

08Occurrence & distribution

Record type43 records

Wild obs. + sensor32

Museum / vouchered9

Cultivated / captive2

Origin

Native2

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 11≤1 km 9≤10 km 1>10 km 3

24 georeferenced · 8 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence9

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
LDlocation not on record	3
Wlocation not on record	3
School of Biology, Aristotle University of Thessalonikilocation not on record	3

3 institutions · 9 of 9 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Crocus hadriaticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)