Crocus gargaricus

Herb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records0

Data sources7

Biological traits9

DNA specimens0

eDNA detections2

Sources7 archives

Databases and archives Crocus gargaricus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS3 compounds

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 8

01Narrative

Crocus gargaricus is a species of flowering plant in the genus Crocus of the family Iridaceae. It is a cormous perennial native to Turkey.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Crocus gargaricus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols2

Plant xanthones1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
kaempferol 3-O-sophoroside	present	LOTUS
Mangiferol	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus gargaricus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHE801138.1 ↗641 bpTurkey

ACGT

TCGAGACCCGAACGAACGGACGATCGCGAACGTGTTATATATTTGCTAACATAAACAACTCCGATTCGTCCCGCCGCCCCTCCCGGCGTG …

Crocus gargaricus subsp. gargaricus genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher GAT:7255

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus gargaricus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Ploidydiploid inferred

Chromosome records8–302n range8median8mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 82×CCDB · book-fedorov

CCDB · book-fedorov — Mather 1932

CCDB · book-fedorov — Karasawa 1937, 1943, 1951

2n 301×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — BRIGHTON, C., B. MATHEW, & C.J. MARCHANT. 1973. Chromosome counts in the genus Crocus. Kew Bull. 28: 451-464.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.924 ↗

09Environmental DNA2 detections

Where the DNA of Crocus gargaricus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)