Crocus flavus

Weston · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records730

Data sources9

Biological traits24

DNA specimens2

eDNA detections3

Sources9 archives

Databases and archives Crocus flavus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility730 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Occurrence & distributionGBIF730 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 8

01Narrative

Crocus flavus, aussi appelé Crocus jaune néerlandais ou crocus des neiges, est une espèce de plantes à fleurs de la famille des Iridaceae et du genre Crocus. Il pousse à l'état sauvage sur les pentes de la Grèce, de l'ex-Yougoslavie, de la Bulgarie, de la Roumanie, du nord-ouest de la Turquie, et du Liban, avec des fleurs orange jaune orangé vif parfumées. C'est un petit crocus, malgré les noms de certains cultivars, comparé aux crocus hollandais géants. Ses cultivars sont utilisés comme plantes ornementales. L'épithète spécifique latin flavus signifie « jaune ».

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology4

Plant height0.125 m

⚠ sources differ — GIFT: 0.125 m · LEDA: 0.125 m · TRY: 0.142 m

Plant height generative0.125 m

Plant height max0.3 m

Plant height min0.08 m

Life cycle & reproduction10

Dehiscencedehiscent

Dispersal typeanimal

Flowering endApr

Flowering startFeb

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualabsent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus flavus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN955427.1 ↗650 bp

ACGT

ATTGTCGAGACCCGAACGAACGGACGATCGCGAACGCGTTACATACTTGCTTACCAAAACAACTCCGGCTCGTCCCGCCGCGCCTCGCGG …

Crocus flavus voucher 062619 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crocus flavus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Ploidydiploid inferred

Chromosome records8–302n range8median8mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 85×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +1

CCDB · ipcn-api-dl — Papanicolaou, K. & E. Zacharof. 1980. Crocus in Greece: new taxa and chromosome numbers. Bot. Not. 133: 155–163.

CCDB · book-ipcn72 — MATHEW, B., & C.A. BRIGHTON. 1972. A new Crocus from Turkey. Kew Bull. 27: 327-329.

CCDB · book-ipcn67-71 — KOZUHAROV, s.' M. POPOVA, & B. KUZMANOV. 1968. Cytotaxonomic studies on Bulgarian flowering plants. Genetics & Plant Breeding 1: 251-255.

CCDB · book-ipcn75-78 — Brighton 1976

2n 143×CCDB · book-ipcn67-71 · CCDB · book-fedorov

CCDB · book-ipcn67-71 — TARNAVSCHI, I.T . & r. LUNGEANU. 1970. In IOPB chromosome number reports XXVIII. Taxon 19: 608-610.

CCDB · book-fedorov — Nakajima 1936

CCDB · book-fedorov — Karasawa 1943

2n 151×CCDB · book-fedorov

CCDB · book-fedorov — Karasawa 1932b

2n 301×CCDB · book-fedorov

CCDB · book-fedorov — Karasawa 1935

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.945 ↗

08Occurrence & distribution

Record type730 records

Wild obs. + sensor654

Museum / vouchered65

Cultivated / captive2

Other9

Origin

Native2

Introduced1

Range

Area of Occupancy AOO2 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 123≤1 km 128≤10 km 200>10 km 109

560 georeferenced · 94 without coordinates

Open the mapobservation + sensor654

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 24≤1 km 7≤10 km 8>10 km 1

40 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence65

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	11
KMNlocation not on record	10
Bern, CH	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Fulda, DE	2
MeiseBGlocation not on record	2
GJOlocation not on record	2
Salzburg, AT	1
Ann Arbor, US	1
Bergen, NO	1
BRNUlocation not on record	1
Frankfurt am Main	1
Chongqing Museumlocation not on record	1
Wlocation not on record	1
LfUlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Lausanne, CH	1
Universität Göttingenlocation not on record	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Oswego, US	1
LDlocation not on record	1
PRClocation not on record	1
Henderson State Universitylocation not on record	1
Bronx, US	1
South Kensington, GB	1

26 institutions · 51 of 65 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Crocus flavus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)