Crocus etruscus

Parl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Crocus

At a glance

Occurrence records296

Data sources13

Biological traits11

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Crocus etruscus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility296 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF296 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT6.5 Gbp

01Narrative

Crocus etruscus (Tuscan crocus) is a species of flowering plant in the genus Crocus of the family Iridaceae, endemic to woodlands of Central Tuscany (Italy). It is a cormous perennial growing to 8 cm tall. The lilac flowers with purple veining and prominent orange stigmas appear in early spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass6.27 mg

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Crocus etruscus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
kaempferol 3-O-sophoroside	present	LOTUS
Kaempferol 3-rutinosyl 7-O-beta-glucoside	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crocus etruscus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHG518186.1 ↗634 bp

ACGT

TCGAGACCCGAACAAACGGACGATCGCGAACGTGTTACATCCTTACTTACTACTCTGTCTCGTCCCGCCGCTCCTCGCGGCGTGGCGTGG …

Crocus etruscus genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher PI<ITA>:s/n, isolate F

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS6

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Crocus etruscus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size6 491 475 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Crocus etruscus6.49 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 8 n = 4

Ploidy2× diploid · measured

Chromosome records8–242n range8median8mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 810×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · fl-europaea +5

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — BALDINI R.M. - 1990. Caryological observations on two Crocus species (Iridaceae) from Tuscany (Italy).. Caryologia , 43(3-4): 341-345.

CCDB · ita-fl — BRIGHTON C.A., MATHEW B., MARCHANT C.J. - 1973. Chromosome counts in the genus Crocus (Iridaceae).. Kew. Bull. , 28(3): 451-464.

CCDB · fl-europaea — Brighton et al.,

CCDB · ipcn-api-dl — Baldini, R. M. 1990. Karyological observations on two Crocus species (Iridaceae) from Tuscany (Italy). Caryologia 43: 341–345.

CCDB · book-ipcn73-74 — BRIGHTON, C., B. MATHEW, & C.J. MARCHANT. 1973. Chromosome counts in the genus Crocus. Kew Bull. 28: 451-464.

CCDB · book-fedorov — Karasawa 1937, 1943

CCDB · book-atlas-flowering-plants — Karasawa 1943

CCDB · kew — Brandizzi F, Grilli Caiola M. 1996. Quantitative DNA analysis in different Crocus species (Iridaceae) by means of flow cytometry. Giornale Botanico Italiano 130: 643-645.

2n 113×CCDB · ita-fl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ita-fl — MATHER K. - 1932. Chromosome variation in Crocus I.. J. Genetics , 26: 129-142.

CCDB · book-fedorov — Mather 1932

CCDB · book-atlas-flowering-plants — Mather 1932

2n 161×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — ROGERS, O. M., & D. E. WALKER. 1967. Chromosome numbers of some cultivated Crocus. Jour. Heredity 58: 68.

2n 241×CCDB · ita-fl

CCDB · ita-fl — BRANDIZZI F., GRILLI CAIOLA M. - 1997 (1996). Quantitative DNA analysis in different Crocus species (Iridaceae) by means of flow cytometry.. Giorn. Bot. Ital. , 130(2): 643-645.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.806 ↗

08Occurrence & distribution

Record type296 records

Wild obs. + sensor174

Museum / vouchered120

Cultivated / captive2

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤100 m 2>10 km 24

26 georeferenced · 148 without coordinates

Open the mapobservation + sensor174

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence120

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
BIO-UNIPIlocation not on record	97
Institut und Museum fuer Geologie und Palaeontologielocation not on record	17
Wlocation not on record	2
SLU Artdatabankenlocation not on record	2
LDlocation not on record	1

5 institutions · 119 of 120 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Crocus etruscus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C

Min temp (night)9.30 °C

Precipitation72.2 mm/mo

Air humidity58.3 %

Moisture balance-20.6 mm/mo

Vapour deficit782 Pa

Wind speed2.60 m/s

Cloud cover40.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)