Crepis capillaris
(L.) Wallr. · speciesAt a glance
Occurrence records387 452
Data sources15
Biological traits73
DNA specimens44
eDNA detections45
Sources15 archives
Databases and archives Crepis capillaris's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility387 452 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources73 traits
Chemical compositionLOTUS · NPASS54 compounds
Occurrence & distributionGBIF387 452 records
Environmental DNA2 datasets · 9 countries45 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB · GIFT · GoaT2 Gbp
01Narrative
Crepis capillaris, the smooth hawksbeard, is a species of flowering plant in the tribe Cichorieae within the family Asteraceae, and is native to Europe. It has become naturalized in other lands and is regarded as a weed in some places.Altervista Flora Italiana, Radicchiella capillare, almeirôa, Grüner Pippau, grönfibbla, Crepis capillaris (L.) Wallr. includes photos and European distribution mapFlora of North America, Smooth hawksbeard, crépis capillaire, Crepis capillaris (Linnaeus) WallrothBiota of North America Program 2014 county distribution map Crepis capillaris is a low, annual plant common in disturbed ground and open habitats, such as thin grassland, lawns, spoil heaps, rocky banks and on roadsides, the stems often trailing along the ground but sometimes erect, the leaves sometimes forming a rosette. It flowers from June to December in the Northern Hemisphere, producing an array of numerous small flower heads. Each head has as many as 60 yellow ray florets but no disc florets.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit length2 mm
Fruit length max2.5 mm
Fruit length min1.5 mm
Leaf length75 mm
Leaf length max300 mm
Leaf length min30 mm
Leaf mass48.05 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 1 626 mm² · GIFT: 1 586 mm²
Leaf width20 mm
Leaf width max50 mm
Leaf width min5 mm
Plant height0.287 m
⚠ sources differ — GIFT: 0.287 m · AusTraits: 0.825 m · LEDA: 0.275 m · TRY: 0.425 m
Plant height generative0.506 m
Plant height max1.2 m
Plant height min0.1 m
Seed length2 mm
Seed length max2 mm
Seed length min2 mm
Seed mass0.232 mg
Seed mass max0.289 mg
Seed mass min0.18 mg
Seed volume0.35 mm³
Seed volume max0.38 mm³
Seed volume min0.32 mm³
Life cycle & reproduction19
Deciduousnesshibernal
⚠ sources differ — TRY: hibernal · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: dysochor · GIFT: anemochorous
Flower colourred
Flowering endAug
Flowering startJun
Flowering timeyynnnnnnnnny
Life formannual or biennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual biennial · LEDA: annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacitypartial_resprouting
Seed number4 020
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 800 m
Elevation mean2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: forb-annual
Habitat GIFTCoastal
Leaf compoundnesssimple
Leaf formruncinate
Leaf shapelanceolate narrowly_lanceolate oblanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio16.68 g/g
Leaf c451 mg/g
Leaf dry-matter content (LDMC)127 mg/g
Leaf n27.51 mg/g
Leaf p2.32 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)43.06 mm²/mg
⚠ sources differ — TRY: 43.06 mm²/mg · LEDA: 28.4 mm²/mg · GIFT: 28.07 mm²/mg
Other traits3
Diaspore typegerminule
Seeds per fruit>1000
Shoot orientationascending
03Chemical composition54 compounds
Compounds documented for Crepis capillaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Stemona alkaloids32
Guaiane sesquiterpenoids6
Stigmastane steroids3
Oleanane triterpenoids2
Taraxerane triterpenoids2
Documented compounds54 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | LOTUS | |
| (1R,2R,3R,6R,7R,8R,14R,19R)-7-ethyl-8-hydroxy-3-methyl-19-[(2R,4R)-4-methyl-5-oxooxolan-2-yl]-5,17-dioxa-13,15-diazapentacyclo[11.4.2.01,14.02,6.08,14]nonadecane-4,16-dione | present | NPASS | |
| (1R,2S,3S,6R,7S,14S)-7-ethyl-1-hydroxy-3-methyl-14-[(2S,4S)-4-methyl-5-oxooxolan-2-yl]-5-oxa-13-azatricyclo[11.2.1.02,6]hexadecane-4,8,16-trione | present | NPASS | |
| (1R,2S,3S,6S,7R,10S)-2-ethyl-1-hydroxy-6-methyl-10-[(2S,4S)-4-methyl-5-oxooxolan-2-yl]-4-oxa-11-azatricyclo[9.4.1.03,7]hexadecane-5,8,16-trione | present | NPASS | |
| (1R,3R,9R,10R,11S,14S,15S,16R)-10-ethyl-14-methyl-3-[(2S,4S)-4-methyl-5-oxooxolan-2-yl]-12-oxa-4-azatetracyclo[7.6.1.04,16.011,15]hexadecan-13-one | present | NPASS | |
| (1R,3S,9R,10R,11R,14S,15S,16R)-10-ethyl-14-methyl-3-[(2R,4S)-4-methyl-5-oxooxolan-2-yl]-12-oxa-4-azatetracyclo[7.6.1.04,16.011,15]hexadecan-13-one | present | NPASS | |
| (1R,9R,10R,11S,14R,15S,16R)-10-ethyl-14-methyl-12-oxa-4-azatetracyclo[7.6.1.04,16.011,15]hexadecan-13-one | present | NPASS | |
| (1S,2R,3S,3'S,4S,6R)-3-ethyl-3'-methylspiro[5-oxa-10-azatricyclo[8.3.0.02,6]tridecane-4,5'-oxolane]-2',11-dione | present | NPASS | |
| (1S,2R,3S,6R,11S)-3-methyl-11-[(2S,4S)-4-methyl-5-oxooxolan-2-yl]-5-oxa-10-azatricyclo[8.3.0.02,6]tridecan-4-one | present | NPASS | |
| (1S,2S,3S,6R,7S,14S)-7-ethyl-3-methyl-14-[(2S,4S)-4-methyl-5-oxooxolan-2-yl]-5-oxa-13-azatricyclo[11.2.1.02,6]hexadecane-4,8,16-trione | present | NPASS |
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crepis capillaris has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes7
GenBank sequences10
eDNA detections45
Countries11
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCC …
Crepis capillaris voucher PLT.0034 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL2★rbcLa★trnL-F★ITS6★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Crepis capillaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 956 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Crepis capillaris1.96 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 6 n = 3
Ploidy2× diploid · measured
Chromosome records6–242n range6median6mode159records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6144×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +18
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Murín A., 1986: Karyological study of the Slovak flora XVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 85-92.
CCDB · brit-fl — Edmonds, J.M., Sell, P.D., Walters, S.M. Watsonia 10: 159-161 (1974)
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3935
CCDB · fl-europaea — Gross, 1966
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · book-ipcn65 — Grif & S. 1965
CCDB · ipcn-api-dl — Ikeda, H. 1988. Karyomorphological studies on the genus Crepis with special reference to C-banding pattern. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 22: 65–117.
CCDB · ipcn-api-dl — Ambros, P. F., M. A. Matzke & A. J. M. Matzke. 1986. Detection of a 17kb unique sequence (T-DNA) in plant chromosomes by in situ hybridization. Chromosoma 94: 11–18.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Ikeda-Komatsu, H. & R. TANAKA. 1983. C-bands in the amphiplasty in two interspecific F;i1 hybrids of Crepis. Jap. J. Genet. 58: 405–410.
CCDB · ipcn-api-dl — Kodama, A. & J. P. Mitchell. 1982a. Relative DNA content of individual chromosomes, karyotype and ploidy in crown gall tumor cells of Crepis capillaris. Jap. J. Genet. 57: 163–169.
CCDB · ipcn-api-dl — Ikeda-Komatsu, H. 1989. Differential amphiplasty in meiosis of F1 hybrid of Crepis capillaris x C. vesicaria ssp. taraxacifolia by means of silver staining. Jap. J. Genet. 64: 1–8.
CCDB · ipcn-api-dl — Noguchi, J. & T. Ohno. 1989. The reaction to C-banding of C-banded constituents during mitotic cycle of Crepis capillaris. Bot. Mag. (Tokyo) 102: 207–218.
CCDB · ipcn-api-dl — Parker, J. S., G. H. Jones, C. Tease & R. W. Palmer. 1976. Chromosome-specific control of chiasma formation in Hypochoeris and Crepis. Pp. 133--142 in K. Jones & P. E. Brandham (editors), Current Chromosome Research.
CCDB · ipcn-api-dl — Taniguchi, K. & R. Tanaka. 1991. Visualization of replicating bands in plant chromosomes with a monoclonal anti-BrdU antibody method. Jap. J. Genet. 66: 485–489.
CCDB · ipcn-api-dl — Rueda, J., F. J. Espino, M. L. Ruiz & A. M. Vázquez. 1988. Intranuclear regulation of cell proliferation. Genome 30: 352–355.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Murín, A. 1986. Karyological study of the Slovak flora XVIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 85–92.
CCDB · ipcn-api-dl — Hizume, M. 1993. Chromosomal localization of 5S rRNA genes in Vicia faba and Crepis capillaris. Cytologia 58: 417–421.
CCDB · ipcn-api-dl — Fuchs, J., A. Brandes & I. Schubert. 1995. Telomere sequence localization and karyotype evolution in higher plants. Pl. Syst. Evol. 196: 227–241.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Noguchi, J. & R. TANAKA. 1981. C-banding after aceto-orcein staining for plant chromosomes. Jap. J. Genet. 56: 529–532.
CCDB · ipcn-api-dl — Sacristan, M. D. 1971. Karyotypic changes in callus cultures from haploid and diploid plants of Crepis capillaris (L.) Wallr. Chromosoma 33: 273–283.
CCDB · ipcn-api-dl — Sacristan, M. D. & M. F. Wendt-gallitelli. 1973. Tumorous cultures of Crepis capillaris: Chromosomes and growth. Chromosoma 43: 279–288.
CCDB · ipcn-api-dl — Schweizer, D. 1973. Differential staining of plant chromosomes with giemsa. Chromosoma 40: 307–320.
CCDB · ipcn-api-dl — Siljak-yakovlev, S. & a. Cartier. 1979. Utilisation de la coloration differentielle au Giemsa dans l'analyse des caryotypes de quatre Crepis. Rev. Cytol. Biol. Vég., Bot. 2: 13–20.
CCDB · ipcn-api-dl — Tanaka, N. Y. 1981a. Studies on chromosome arrangement in some higher plants III. Haplopappus gracilis (2n=4) and Crepis capillaris (2n=6). Cytologia 46: 545–559.
CCDB · ipcn-api-dl — Tease, C. & G. H. Jones. 1976. Chromosome-specific control of chiasma formation in Crepis capillaris. Chromosoma 57: 33–49.
CCDB · ipcn-api-dl — Ferrer, E. & J. R. Lacadena. 1977. Homologous somatic association in radial metaphases of Crepis species. Chromosoma 64: 25–36.
CCDB · ipcn-api-dl — Lacadena, J. R. & E. Ferrer. 1978. Homologous somatic association in Crepis species: A critical comparison of several statistical approaches. Chromosoma 67: 77–86.
CCDB · ipcn-api-dl — LEUTE, G. H. 1977. In IOPB chromosome number reports LVII. Taxon 26: 443–452.
CCDB · ipcn-api-dl — Tanaka, R. & K. TANIGUCHI. 1975. A banding method for plant chromosomes. Jap. J. Genet. 50: 163–167.
CCDB · ipcn-api-dl — Taniguchi, K., R. Tanaka, Y. Yonezawa & H. KOMATSU. 1975. Types of banding patterns of plant chromosomes by modified BSG method. Kromosomo, II 100: 3123–3135.
CCDB · book-ipcn67-71 — WAGENAAR, E.B. 1969. End-to-end chromosome attachments in mitotic interphase and their possible significance to meiotic chromosome pairing. Chromosoma 26: 410-426.
CCDB · book-ipcn67-71 — KUROIWA, T., & N. TANAKA. 1970. DNA replication pattern in somatic chromosomes of Crepis capillaris. Cytologia 35: 271-279.
+104 more references
2n 812×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · ita-fl — BRULLO S., PAVONE P., TERRASI M.C., ZIZZA A. - 1977 (1976). Numeri cromosomici per la flora italiana:299-314.. Inform. Bot. Ital. , 9(1): 57-71.
CCDB · ita-fl — BRULLO S., GUGLIELMO A., PAVONE P., TERRASI M.C. - 1992 (1991). Numeri cromosomici per la flora italiana: 1251-1266.. Inform. Bot. Ital. , 23(1): 39-47.
CCDB · ipcn-api-dl — Ikeda, H. 1988. Karyomorphological studies on the genus Crepis with special reference to C-banding pattern. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 22: 65–117.
CCDB · ipcn-api-dl — Brullo, S., A. Guglielmo, P. Pavone & M. C. Terrasi. 1991. Numeri cromosomici per la flora Italiana: 1251--1266. Inform. Bot. Ital. 23: 39–46.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Gemeinholzer. 2005. New chromosome counts for some Lactuceae (Compositae). Compositae Newslett. 42: 43–46.
CCDB · book-ipcn67-71 — WAGENAAR, E.B. 1969. End-to-end chromosome attachments in mitotic interphase and their possible significance to meiotic chromosome pairing. Chromosoma 26: 410-426.
CCDB · book-ipcn75-78 — Brullo et al. 1977
CCDB · book-ipcn75-78 — Kamari 1976
CCDB · book-atlas-flowering-plants
CCDB · kew — Brown L, Jones N (pers. comm. 1975)
2n 122×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Vapper, M. & H. Kallack. (1986). Karyotypic differentiation of long-term callus culture of Crepis capillaris. Biol. Pl. 28: 417-423 Praha
CCDB · CromoCat 2015 — Yazawa, S. (1967). Cytological and morphological observations on the callus tissue of Crepis capillaris. Bot. Mag., Tokyo 80: 413-420.
2n 71×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Vincent, J. E. & G. H. Jones. (1993). Meiosis in autopolyploid Crepis capillaris. I. Triploids and trisomics; implications for models of chromosome pairing Chromosoma 102: 195-206
2n 91×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Vincent, J. E. & G. H. Jones. (1993). Meiosis in autopolyploid Crepis capillaris. I. Triploids and trisomics; implications for models of chromosome pairing Chromosoma 102: 195-206
2n 241×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Yazawa, S. (1967). Cytological and morphological observations on the callus tissue of Crepis capillaris. Bot. Mag., Tokyo 80: 413-420.
n 315×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 471-478. Mejas, J. A.Lagascalia14(2): 289-292(1986).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 618-619. Izuzquiza, A.Lagascalia15(2): 295-296(1990).
CCDB · ipcn-api-dl — Mejías, J. A. 1986. Números cromosómicos para la flora Española, 471--478. Lagascalia 14: 289–292.
CCDB · ipcn-api-dl — Izuzquiza, A. 1990. Números cromosómicos para la flora Española. 618--619. Lagascalia 15: 295–296.
CCDB · ipcn-api-dl — de Roon, A. C. & S. Dressler. 1997. New taxa of Norantea Aubl. s.l. (Marcgraviaceae) from Central America and adjacent South America. Bot. Jahrb. Syst. 119(3): 327–335.
CCDB · ipcn-api-dl — Tanaka, N. Y. 1981a. Studies on chromosome arrangement in some higher plants III. Haplopappus gracilis (2n=4) and Crepis capillaris (2n=6). Cytologia 46: 545–559.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — DI FULVIO, T. E. 1967. Recuentos cromosomicos en angiospermas argentinas. Kurtziana 4: 87-90.
CCDB · book-ipcn73-74 — SHIMIZU, Y. 1973. New plants for teaching (2). I den 2 7 ( 1 0 l : 7 1-7 9 .
CCDB · CromoCat 2015 — Fulvio, T. E., di (1967). Recuentos cromosómicos en Angiospermas argentinas. Kurtziana 4: 87-90.
CCDB · CromoCat 2015 — Izuzquiza, A. (1990). Números cromosómicos para la flora española. 618-619. Lagascalia 15(2): 295-296.
CCDB · CromoCat 2015 — Mejías, J. A. (1986). Números cromosómicos para la flora española, 471-478. Lagascalia 14(2): 289-292.
CCDB · CromoCat 2015 — Roon, M. K., van & J. H. Wieffering. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 367.
CCDB · CromoCat 2015 — Taylor, R. L. & G. A. Mulligan. (1968). Flora of the Queen Charlotte Island. Part 2. Cytologiacl aspects of the Vascular Plants. Queen's Printer Ottawa
n 41×CCDB · Cave1957
CCDB · Cave1957 — Petit
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97% BUSCO
07Deep time~4.34 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin4.34 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type387 452 records
Wild obs. + sensor378 476
Museum / vouchered8 023
Cultivated / captive135
Other818
Origin
Native30 381
Introduced1 818
Range
Area of Occupancy AOO362 124 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy33% within 1 km
≤100 m 35 561≤1 km 72 443≤10 km 216 668>10 km 2 209
326 881 georeferenced · 51 595 without coordinates
Open the mapobservation + sensor378 476
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy62% within 1 km
≤100 m 1 369≤1 km 1 395≤10 km 1 541>10 km 124
4 429 georeferenced · 3 594 without coordinates
Open the institutions mapphysical evidence8 023
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 16
16 georeferenced · 119 without coordinates
Open the mapnot free-living135
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions155 of 271 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| SLU Artdatabankenlocation not on record | 562 |
| LDlocation not on record | 532 |
| DBF-NHMDlocation not on record | 466 |
| Uniwersytet Wrocławskilocation not on record | 399 |
| MeiseBGlocation not on record | 268 |
| BDBClocation not on record | 211 |
| BClocation not on record | 181 |
| Canberra, AU | 177 |
| Oskarshamn, SE | 173 |
| Museo Entomologico de Leonlocation not on record | 148 |
| BFLlocation not on record | 140 |
| Entomological Society of Latvialocation not on record | 138 |
| Mount Annan, AU | 120 |
| Christchurch, NZ | 111 |
| Adelaide, AU | 106 |
| Salzburg, AT | 105 |
| South Kensington, GB | 103 |
| Auckland, NZ | 99 |
| BIO-UNIPIlocation not on record | 97 |
| Provincia di Livornolocation not on record | 93 |
| Barcelona, ES | 92 |
| Görlitz, DE | 88 |
| Hobart, AU | 86 |
| Corvallis, US | 84 |
| WTUlocation not on record | 79 |
| València, ES | 78 |
| CICYTEXlocation not on record | 76 |
| MAlocation not on record | 72 |
| Berlin, DE | 70 |
| Pullman, US | 62 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 62 |
| Vitoria, ES | 61 |
| Vancouver, CA | 56 |
| Pamplona, ES | 56 |
| Chongqing Museumlocation not on record | 55 |
| Salamanca, ES | 53 |
| BRNUlocation not on record | 51 |
| Philadelphia, US | 48 |
| Bronx, US | 43 |
| Adam Mickiewicz University in Poznańlocation not on record | 40 |
| Wellington, NZ | 39 |
| Badajoz, ES | 38 |
| Mlocation not on record | 35 |
| Jaén, ES | 34 |
| GJOlocation not on record | 33 |
| Olocation not on record | 32 |
| Victoria, CA | 27 |
| Uniwersytet Śląski w Katowicachlocation not on record | 26 |
| College of the Atlantic, Museumlocation not on record | 26 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 26 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 25 |
| Wlocation not on record | 24 |
| Bern, CH | 24 |
| Frankfurt am Main | 24 |
| Uniwersytet Warszawskilocation not on record | 23 |
| Madrid, ES | 22 |
| Armidale, AU | 22 |
| Natural History Museum Rotterdamlocation not on record | 22 |
| Wuzhou, CN | 22 |
| Uppsala, SE | 21 |
| Coimbra, PT | 20 |
| Moscow State Universitylocation not on record | 18 |
| Rotorua, NZ | 18 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 18 |
| University of Stellenboschlocation not on record | 18 |
| Johnson City, US | 17 |
| PRClocation not on record | 16 |
| Chapel Hill, US | 16 |
| Kew, GB | 16 |
| Brisbane, AU | 16 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Bangkok, TH | 15 |
| National Biodiversity Institute, Costa Ricalocation not on record | 15 |
| Moscow, US | 15 |
| Córdoba, ES | 13 |
| Ann Arbor, US | 13 |
| Saint Louis, US | 13 |
| PrivatHerblocation not on record | 13 |
| Granada, ES | 12 |
| Stockholm, SE | 12 |
| Palmerston North, NZ | 12 |
| Kensington, AU | 11 |
| Porrentruy, CH | 11 |
| Arcata, US | 11 |
| San Isidro, AR | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Zürich, CH | 10 |
| Bloomington, US | 10 |
| Laboratory of Palaeontologylocation not on record | 10 |
| John T. Waterhouse Herbariumlocation not on record | 10 |
| Phyletisches Museum Jenalocation not on record | 10 |
| Angwin, US | 9 |
| New Haven, US | 9 |
| Sevilla, ES | 9 |
| QVMAGlocation not on record | 9 |
| San Diego, US | 9 |
| Québec, CA | 9 |
| Pamplona, ES | 9 |
| Portland, US | 9 |
| Dresden, DE | 8 |
| KMNlocation not on record | 8 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 8 |
| Tilburg, NL | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Tacoma, US | 8 |
| Zürich, CH | 7 |
| Acadia Universitylocation not on record | 7 |
| Palacký University in Olomouclocation not on record | 7 |
| Claremont, US | 7 |
| Allentown, US | 7 |
| GZUlocation not on record | 7 |
| Alicante, ES | 6 |
| Museo Achille Folettolocation not on record | 6 |
| Davis, US | 6 |
| Odawara, JP | 6 |
| Boise, US | 6 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 6 |
| Frauenfeld, CH | 6 |
| Provo, US | 6 |
| CJBGlocation not on record | 5 |
| Ashland, US | 5 |
| Universidade Federale do Rio Grande do Sullocation not on record | 5 |
| John May Museum of Natural Historylocation not on record | 5 |
| BSBIlocation not on record | 5 |
| San Luis Obispo, US | 5 |
| Porto Alegre, BR | 5 |
| Glarus, CH | 5 |
| Córdoba, AR | 5 |
| San José, CR | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Fulda, DE | 5 |
| Monastir, TN | 4 |
| Bergen, NO | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Honolulu, US | 4 |
| College Park, US | 4 |
| Williamsburg, US | 4 |
| Karlsruhe, DE | 4 |
| Trondheim, NO | 4 |
| Uniwersytet Opolskilocation not on record | 4 |
| Xiamen, CN | 4 |
| Riverside, US | 4 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| University of New Hampshirelocation not on record | 3 |
| Gijón, ES | 3 |
| SZUlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Chiba, JP | 3 |
| DASSHlocation not on record | 3 |
| Pretoria, ZA | 3 |
| Durango, MX | 3 |
| UChlocation not on record | 3 |
| Paris, FR | 3 |
| San Jose, US | 3 |
| Bourges, FR | 3 |
| Batemans Bay, AU | 3 |
| CASlocation not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Whitehorse, CA | 3 |
| Santa Cruz, US | 3 |
| McWane Science Centerlocation not on record | 3 |
| Santiago, CL | 2 |
| UGentlocation not on record | 2 |
| NoColllocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Buenos Aires, AR | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Podgorica, ME | 2 |
| Winterthur, CH | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Portland, US | 2 |
| Montréal, CA | 2 |
| ASUlocation not on record | 2 |
| Denver, US | 2 |
| EL PASO, US | 2 |
| Campo Mourão, BR | 2 |
| ISAlocation not on record | 2 |
| BISHlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Sion, CH | 2 |
| FLADlocation not on record | 2 |
| Sagamihara, JP | 2 |
| Parkville, AU | 2 |
| Wollongong, AU | 2 |
| Morgantown, US | 2 |
| Columbia, US | 2 |
| Sant Julià de Lòria, AD | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Oulu, FI | 2 |
| BGBMlocation not on record | 2 |
| Norfolk, US | 2 |
| UTFPR-CPlocation not on record | 2 |
| University of British Columbia, Herbariumlocation not on record | 2 |
| Beijing, CN | 2 |
| IDElocation not on record | 2 |
| Burlington, US | 2 |
| San Francisco, US | 2 |
| CIBIOlocation not on record | 2 |
| Kochi, JP | 2 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| GB | 1 |
| Missoula, US | 1 |
| Clemson, US | 1 |
| Pittsburg, US | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| Saint John, CA | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| AASlocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Taipei, TW | 1 |
| OLAlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Cape Town, ZA | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Helsinki, FI | 1 |
| Cenargenlocation not on record | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| Logan, US | 1 |
| UTPLlocation not on record | 1 |
| TROMlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Hudson, US | 1 |
| Boumlocation not on record | 1 |
| Little Rock, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Brookings, US | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Elikins, US | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Minia, EG | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Brasília, BR | 1 |
| Chicago, US | 1 |
| H-AkrKGlocation not on record | 1 |
| Pelotas, BR | 1 |
| Madison, US | 1 |
| Philadelphia, US | 1 |
| Uberlândia, BR | 1 |
| München, DE | 1 |
| Cheney, US | 1 |
| Tempe, US | 1 |
| Oswego, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Bend, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| QCNElocation not on record | 1 |
| Due West, US | 1 |
| Albuquerque, US | 1 |
| Flagstaff, US | 1 |
| Valparaíso, CL | 1 |
| Aarhus, DK | 1 |
| Castelar, AR | 1 |
| Garðabær, IS | 1 |
| Knoxville, US | 1 |
| La Trobe Universitylocation not on record | 1 |
| Los Angeles, US | 1 |
| H-Schuhwlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Bothell, US | 1 |
271 institutions · 7 034 of 8 023 vouchered records shown · 779 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA45 detections
Where the DNA of Crepis capillaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found45
Studies independent surveys2
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 45 detections have coordinates
Open the map9 countries0
Roadside near creek.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median6.00 °C 6.00–17.4
Seasonal swing summer↔winter13.6 °C
Max temp (day)8.00 °C 8.00–20.6
Min temp (night)3.90 °C 3.90–14.1
Precipitation68.3 mm/mo 68.3–102
Air humidity64.3 % 58.1–64.3
Moisture balance10.8 mm/mo -40.5–25.6
Vapour deficit335 Pa 335–804
Wind speed5.30 m/s 2.00–5.30
Cloud cover49.0 % 37.2–49.0
CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.