Crepidotus carpaticus

Pilát · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Crepidotaceae/Crepidotus

At a glance

Occurrence records102

Data sources7

Biological traits0

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Crepidotus carpaticus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF102 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Crepidotus carpaticus, is a species of saprophytic fungus in the family Crepidotaceae with a stipeless sessile cap. The fungus was described by Albert Pilát in 1929 and is commonly found in France, the United Kingdom, and Ireland. The GBIF database indicates this species may be an orthographic variant.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crepidotus carpaticus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR286991.1 ↗647 bpUnited Kingdom · 2020

ACGT

ACCCCCCCGGGGGTATGTGCTCATCCGCCATCTTTATCTTTCCACCTGTGCACACACTGCAGTCCTGGGAGGAAGCACGAGAGAAGCAGG …

Crepidotus carpaticus voucher NA12102020 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type102 records

Wild obs. + sensor71

Museum / vouchered31

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 1≤1 km 5≤10 km 61

67 georeferenced · 4 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 7

10 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	9
Copenhagen, DK	4
San Sebastián, ES	2
MeiseBGlocation not on record	2
WU-MYClocation not on record	2
Gijón, ES	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Görlitz, DE	1
Karlsruhe, DE	1

9 institutions · 23 of 31 vouchered records shown · 8 without an institution code

09Environmental DNA1 detections

Where the DNA of Crepidotus carpaticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 17.7–17.7

Seasonal swing summer↔winter2.00 °C

Max temp (day)21.2 °C

Min temp (night)13.8 °C

Precipitation251 mm/mo

Air humidity66.9 %

Moisture balance151 mm/mo

Vapour deficit666 Pa

Wind speed2.40 m/s

Cloud cover66.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)