Crepidotus brunnescens

Hesler & A.H.Sm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Crepidotaceae/Crepidotus

At a glance

Occurrence records22

Data sources7

Biological traits0

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Crepidotus brunnescens's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF22 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Crepidotus brunnescens, is a species of saprophytic fungus in the family Crepidotaceae with a stipeless sessile cap which is smooth and yellowish-brown. It is often found on hardwood logs such as Quercus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crepidotus brunnescens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences6

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOK346337.1 ↗603 bpUSA · 2017

ACGT

CATTAACGAATAAACTTGGTGGACTGTCGCTGGCATCCCTAGGGATTTGCATGTGCACGTCTGTCATCTTTATATTTCCACCTGTGCACC …

Crepidotus brunnescens voucher MO415104 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type22 records

Wild obs. + sensor16

Museum / vouchered6

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy45% within 1 km

≤100 m 3≤1 km 2≤10 km 4>10 km 2

11 georeferenced · 5 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	2
Private Collection of Django Grootmyerslocation not on record	1
Blacksburg, US	1

3 institutions · 4 of 6 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Crepidotus brunnescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.9 °C 18.3–21.4

Seasonal swing summer↔winter24.7 °C

Max temp (day)25.0 °C 23.7–26.3

Min temp (night)15.4 °C 14.3–16.4

Precipitation96.2 mm/mo 86.5–106

Air humidity58.7 % 58.4–59.0

Moisture balance-34.8 mm/mo -44.9–-24.6

Vapour deficit962 Pa 879–1,045

Wind speed2.90 m/s 2.60–3.20

Cloud cover36.5 % 35.2–37.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)