Craterellus ignicolor

(R.H.Petersen) Dahlman, Danell & Spatafora · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Craterellus

At a glance

Occurrence records930

Data sources6

Biological traits0

DNA specimens0

eDNA detections62

Sources6 archives

Databases and archives Craterellus ignicolor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility930 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF930 records

Environmental DNA2 datasets · 2 countries62 detections

DNA & barcodingNCBIsequences

01Narrative

Cantharellus ignicolor é uma espécie de fungo pertencente à família Cantharellaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Craterellus ignicolor has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections62

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR464452.1 ↗712 bpUSA · 2009

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCATTGAGCATGCAGACCTCTGATTGAGGCTGCACATATGTTTCTT …

Craterellus ignicolor isolate AJF19 SV2 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type930 records

Wild obs. + sensor880

Museum / vouchered50

Range

Area of Occupancy AOO2 904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 314≤1 km 117≤10 km 132>10 km 118

681 georeferenced · 199 without coordinates

Open the mapobservation + sensor880

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 4≤1 km 6≤10 km 7>10 km 3

20 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	19
Université de Montréal Biodiversity Centrelocation not on record	12
Chicago, US	4
Asheville, US	4
Catholic University of Pekinglocation not on record	2
Durham, US	1
Toronto, CA	1
WU-MYClocation not on record	1
St. Paul, US	1
Colorado State Universitylocation not on record	1

10 institutions · 46 of 50 vouchered records shown · 4 without an institution code

09Environmental DNA62 detections

Where the DNA of Craterellus ignicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 15.6–15.6

Seasonal swing summer↔winter21.4 °C

Max temp (day)21.0 °C

Min temp (night)11.5 °C

Precipitation96.6 mm/mo

Air humidity57.8 %

Moisture balance8.20 mm/mo

Vapour deficit743 Pa

Wind speed3.50 m/s

Cloud cover42.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)