Craterellus excelsus

T.W.Henkel & Aime · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Craterellus

At a glance

Occurrence records22

Data sources7

Biological traits0

DNA specimens4

eDNA detections8

Sources7 archives

Databases and archives Craterellus excelsus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility22 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF22 records

Environmental DNA2 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Craterellus excelsus is a species of fungus in the family Cantharellaceae. Reported as a new species in 2009, it was originally collected from the Pakaraima Mountains of Guyana. The species is found in rainforests that are composed predominantly of Dicymbe species. C. excelsus has fruit bodies that may be up to 15 cm in height and grow in dense clusters.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Craterellus excelsus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences4

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC897655.1 ↗451 bpFrench Guiana

ACGT

TCTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCACTGTGTAATGCAGGCCCTTT …

Craterellus excelsus isolate TH9733 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type22 records

Wild obs. + sensor7

Museum / vouchered15

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 7

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 15 records without

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Herbier de Paris(Fr)-MNHNlocation not on record	3
University of Stellenboschlocation not on record	2
Humboldt Herbarium (Berlin, Ge)-HSClocation not on record	1

3 institutions · 6 of 15 vouchered records shown · 8 without an institution code

09Environmental DNA8 detections

Where the DNA of Craterellus excelsus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.1 °C 22.1–24.2

Seasonal swing summer↔winter2.10 °C

Max temp (day)25.5 °C 25.5–28.2

Min temp (night)19.5 °C 19.5–21.1

Precipitation326 mm/mo 251–326

Air humidity72.4 % 68.2–72.4

Moisture balance212 mm/mo 125–212

Vapour deficit730 Pa 730–978

Wind speed1.00 m/s 1.00–1.10

Cloud cover43.2 % 35.7–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)