Craterellus calicornucopioides

D.Arora & J.L.Frank · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Craterellus

At a glance

Occurrence records1 123

Data sources8

Biological traits0

DNA specimens3

eDNA detections175

Sources8 archives

Databases and archives Craterellus calicornucopioides's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 123 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI175 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 123 records

Environmental DNA4 datasets · 7 countries175 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Craterellus calicornucopioides is an edible fungus in the family Cantharellaceae. Described by David Arora and Jonathan L. Frank in 2015, is the North American version of the similar European species Craterellus cornucopioides. Molecular phylogenetics has shown that they are, however, distinct species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Craterellus calicornucopioides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences3

eDNA detections175

Countries7

The DNA barcodea real sequence read deposited for this species

ITSKR560046.1 ↗482 bpUSA · 2015

ACGT

TTACCACTGTGATGCTGAGATATGGGTCTTGAAGCCCTTTGTGATTGCTTTCAGGCATCTGATCTTATCCAGCCCAAAATATCACTCAGT …

Craterellus cf. cornucopioides JLF3744 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type1 123 records

Wild obs. + sensor1 111

Museum / vouchered12

Range

Area of Occupancy AOO2 608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 314≤1 km 126≤10 km 165>10 km 395

1 000 georeferenced · 111 without coordinates

Open the mapobservation + sensor1 111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	4
California State University, East Baylocation not on record	3

2 institutions · 7 of 12 vouchered records shown · 5 without an institution code

09Environmental DNA175 detections

Where the DNA of Craterellus calicornucopioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found175

Studies independent surveys4

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 175 detections have coordinates

Open the map7 countries0

ForestPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.20 °C 2.40–23.8

Seasonal swing summer↔winter16.4 °C

Max temp (day)9.50 °C 3.80–26.1

Min temp (night)4.20 °C -0.2–21.0

Precipitation58.3 mm/mo 37.0–178

Air humidity61.1 % 57.9–69.2

Moisture balance32.2 mm/mo -113–98.7

Vapour deficit413 Pa 226–1,184

Wind speed3.50 m/s 2.50–5.10

Cloud cover36.0 % 22.8–59.2

CHELSA 1981–2010, ~9 km grid, at location & month of 146 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Craterellus calicornucopioides

At a glance

Sources8 archives

At a glance

Record type1 123 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 2 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 123 records