Craterellus caeruleofuscus

A.H.Sm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Cantharellales/Hydnaceae/Craterellus

At a glance

Occurrence records203

Data sources7

Biological traits0

DNA specimens6

eDNA detections5

Sources7 archives

Databases and archives Craterellus caeruleofuscus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF203 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Craterellus caeruleofuscus is a species of fungus in the mushroom family Cantharellaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Craterellus caeruleofuscus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences6

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR471214.1 ↗912 bpUSA · 2020

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTCACTGAGCCATGCAAGACCCCCTTGATTGAGGGCTGCACAAGCTT …

Craterellus caeruleofuscus isolate RAS674 SV1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS1

fungal barcode

08Occurrence & distribution

Record type203 records

Wild obs. + sensor106

Museum / vouchered97

Range

Area of Occupancy AOO596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 56≤1 km 10≤10 km 7>10 km 13

86 georeferenced · 20 without coordinates

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 29≤1 km 12≤10 km 6>10 km 2

49 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	35
Olocation not on record	11
nsnflocation not on record	8
TENN-Flocation not on record	7
Bronx, US	6
Philadelphia, US	4
Oulu, FI	4
Université de Montréal Biodiversity Centrelocation not on record	4
University of Oslo, Natural History Museumlocation not on record	3
ILLSlocation not on record	3
BioFokuslocation not on record	2
Turku, FI	2
Ann Arbor, US	2
TUR-Alocation not on record	1
University of Tennessee, Knoxvillelocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

16 institutions · 94 of 97 vouchered records shown · 3 without an institution code

09Environmental DNA5 detections

Where the DNA of Craterellus caeruleofuscus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Sydvendt blabaereikeskogGammel sydvendt smavokst blabaereikeskogParti med blabaereikeskog i omrade med rik e…Blandingsskog med gran, eik, hassel, rogn og…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.10 °C 7.50–14.8

Seasonal swing summer↔winter17.5 °C

Max temp (day)10.2 °C 9.70–17.9

Min temp (night)5.20 °C 4.70–11.3

Precipitation151 mm/mo 114–153

Air humidity65.0 % 61.9–65.3

Moisture balance126 mm/mo 32.7–126

Vapour deficit371 Pa 360–660

Wind speed2.90 m/s 2.60–3.10

Cloud cover48.2 % 45.0–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)