Crassula rupestris

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records1 365

Data sources8

Biological traits17

DNA specimens3

eDNA detections5

Sources8 archives

Databases and archives Crassula rupestris's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 365 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF1 365 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.5 m

Seed mass0.008 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 200 m

Elevation min50 m

Epiphyteterrestrial

Growth formshrub

Mycorrhiza type0.009449299

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula rupestris has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR392124.1 ↗590 bp

ACGT

TCGCAGCCTTTGAAGCACGACCCGTGGACAAGTTGTTAATTGGGGAGTCAAGGGGATCACTTGTGCTTCCCTTGCCCCTCTGTCGGCCTA …

Crassula rupestris voucher Zhigila & Schmiedel 1180 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Crassula rupestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidypolyploid inferred

Chromosome records14–282n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

CCDB · Oberlander2016 — Friedrich, 1973

2n 282×CCDB · book-ipcn73-74 · CCDB · Oberlander2016

CCDB · book-ipcn73-74 — FRIEDRICH, H.-CH. 1973. Contribution to the cytotaxonomy of the genus Crassula. Garcia de Orta, Ser.Bot. 1: 49-66.

CCDB · Oberlander2016 — Friedrich, 1973

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 365 records

Wild obs. + sensor1 352

Museum / vouchered13

Range

Area of Occupancy AOO2 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 950≤1 km 119≤10 km 35>10 km 37

1 141 georeferenced · 211 without coordinates

Open the mapobservation + sensor1 352

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	5
Wuzhou, CN	1
Bronx, US	1
Cape Town, ZA	1
South African National Biodiversity Institutelocation not on record	1
Alexandria Universitylocation not on record	1
Saint Louis, US	1

7 institutions · 11 of 13 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Crassula rupestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 18.2–18.2

Seasonal swing summer↔winter11.7 °C

Max temp (day)21.4 °C

Min temp (night)15.0 °C

Precipitation3.10 mm/mo

Air humidity59.8 %

Moisture balance-143 mm/mo

Vapour deficit839 Pa

Wind speed4.70 m/s

Cloud cover31.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crassula rupestris

At a glance

Sources8 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 365 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 365 records