Crassula rubricaulis

Eckl. & Zeyh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records419

Data sources8

Biological traits25

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Crassula rubricaulis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF419 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Crassula rubricaulis (Red-stem Crassula) is a succulent plant native to the coastal mountains of the Eastern Cape and Western Cape of South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Leaf length25 mm

Leaf width9 mm

Plant height0.5 m

Plant height max0.5 m

Seed mass0.11 mg

Seed mass max0.2 mg

Seed mass min0.01 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formsucculent subshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max750 m

Elevation min50 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: subshrub

Leaf compoundnesssimple

Leaf shapeoblanceolate

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous woody · GIFT: woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula rubricaulis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMH503587.1 ↗694 bp

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGTAGCCTTTGCAAGCACGACCCGTGGACAAGTTGTTAACTGGGGAGT …

Crassula rubricaulis voucher Bruyns 7039 (BOL) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type419 records

Wild obs. + sensor377

Museum / vouchered42

Origin

Introduced7

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 312≤1 km 32≤10 km 6>10 km 1

351 georeferenced · 26 without coordinates

Open the mapobservation + sensor377

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	30
Museo Entomologico de Leonlocation not on record	3
Durban, ZA	2
MSB-3054location not on record	2
Cape Town, ZA	1
Mount Annan, AU	1
South African National Biodiversity Institutelocation not on record	1
GHPG$location not on record	1
Canberra, AU	1

9 institutions · 42 of 42 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Crassula rubricaulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)