Crassula pubescens — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records382

Data sources4

Biological traits13

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Crassula pubescens's data was compiled from.

GBIFGlobal Biodiversity Information Facility382 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF382 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.3 m

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max2 000 m

Elevation min20 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula pubescens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392113.1 ↗591 bp

ACGT

TGCCAGCCTTTGAAGCACGACCTGTGGACAAGTTGTTAATTGGGGAGTCAAGGGAATCACTTGGCTTCCCTTGCCCCTCTGTCGGCCTAT …

Crassula pubescens voucher Zhigila & Schmiedel 1162 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type382 records

Wild obs. + sensor370

Museum / vouchered12

Range

Area of Occupancy AOO1 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 250≤1 km 26≤10 km 6>10 km 10

292 georeferenced · 78 without coordinates

Open the mapobservation + sensor370

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 12 records without

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	9
Durban, ZA	2
Cape Town, ZA	1

3 institutions · 12 of 12 vouchered records shown