Crassula perforata

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records1 045

Data sources6

Biological traits14

DNA specimens2

eDNA detections3

Sources6 archives

Databases and archives Crassula perforata's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 045 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF1 045 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.25 m

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 200 m

Elevation min50 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayCAM

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula perforata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392112.1 ↗593 bp

ACGT

TCGCAGCCTTTGAAGCACGACCTGTGGACAAGTTGTTAATTGGGGAGTCAAGGGGATCACTTGTGCTTCCCTTGCCCCTCTGTCGGCCTT …

Crassula perforata voucher Zhigila & Muasya 8020 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 045 records

Wild obs. + sensor1 024

Museum / vouchered19

Cultivated / captive2

Origin

Native1

Range

Area of Occupancy AOO2 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 662≤1 km 65≤10 km 17>10 km 26

770 georeferenced · 254 without coordinates

Open the mapobservation + sensor1 024

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence19

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban, ZA	13
Pretoria, ZA	3
Kew, GB	1
MeiseBGlocation not on record	1

4 institutions · 18 of 19 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Crassula perforata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Crassula perforata

At a glance

Sources6 archives

Size & morphology1

Life cycle & reproduction2

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits1

At a glance

Record type1 045 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions3 of 4 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 045 records