Crassula pellucida

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Crassula

At a glance

Occurrence records604

Data sources6

Biological traits22

DNA specimens2

eDNA detections3

Sources6 archives

Databases and archives Crassula pellucida's data was compiled from.

GBIFGlobal Biodiversity Information Facility604 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF604 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.13 m

Plant height max0.25 m

Plant height min0.05 m

Seed mass0.055 mg

⚠ sources differ — TRY: 0.055 mg · GIFT: 0.06 mg

Seed mass max0.06 mg

Seed mass min0.06 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formsucculent subshrub

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Elevation max3 000 m

Elevation min20 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: annual herb

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)80.98 mg/g

Photosynthetic pathwayCAM

Wood density64.14 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crassula pellucida has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences7

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSMH503579.1 ↗696 bp

ACGT

ACCTGCGGAAGGATCATTGTCGCAGCCTTTGCAAGCACGACCGTGGACATGTTGTTAAATTAGGAGCCAAGGAAAGCCCCGTGCTTCCCT …

Crassula pellucida subsp. marginalis voucher Bruyns 12021 (BOL) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type604 records

Wild obs. + sensor543

Museum / vouchered61

Origin

Introduced1

Range

Area of Occupancy AOO1 388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 391≤1 km 47≤10 km 15>10 km 6

459 georeferenced · 84 without coordinates

Open the mapobservation + sensor543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	39
Paris, FR	5
LNBG$location not on record	5
Saint Louis, US	3
Wellington, NZ	1
Kew, GB	1
Claremont, US	1
University of Stellenboschlocation not on record	1
MeiseBGlocation not on record	1
Christchurch, NZ	1
Valparaiso, CL	1

11 institutions · 59 of 61 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Crassula pellucida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)